Korean Journal of Poultry Science
Korean Society of Poultry Science
Article

초기 육계 사료내 토착미세조류(Parachlorella sp.) 첨가에 따른 성장 및 면역반응 변화

안수현1,*https://orcid.org/0000-0001-6236-6815, 주상석2,*https://orcid.org/0000-0001-8909-1102, 이효건2https://orcid.org/0000-0002-3286-7368, 김지훈3https://orcid.org/0000-0002-5056-175X, 이창수3https://orcid.org/0000-0001-7327-4852, 김명후4https://orcid.org/0000-0002-8444-6952, 공창수1,5,https://orcid.org/0000-0002-3876-6488
Su Hyun An1,*https://orcid.org/0000-0001-6236-6815, Sang Seok Joo2,*https://orcid.org/0000-0001-8909-1102, Hyo Gun Lee2https://orcid.org/0000-0002-3286-7368, Z-Hun Kim3https://orcid.org/0000-0002-5056-175X, Chang Soo Lee3https://orcid.org/0000-0001-7327-4852, Myunghoo Kim4https://orcid.org/0000-0002-8444-6952, Changsu Kong1,5,https://orcid.org/0000-0002-3876-6488
1경북대학교 축산BT학과 대학원생
2부산대학교 동물생명자원과학과 대학원생
3국립낙동강생물자원관 조류연구팀 선임연구원
4부산대학교 동물생명자원과학과 교수
5경북대학교 축산학과 교수
1Graduate Student, Department of Animal Science and Biotechnology, Kyungpook National University, Sangju 37224, Republic of Korea
2Graduate Student, Department of Animal Science, College of Natural Resources and Life Sciences, Pusan National University, Miryang 50463, Republic of Korea
3Senior Researcher, Algae Research Team, Nakdongang National Institute of Biological Resources, Sangju 37242, Republic of Korea
4Professor, Department of Animal Science, College of Natural Resources and Life Sciences, Pusan National University, Miryang 50463, Republic of Korea
5Professor, Department of Animal Science, Kyungpook National University, Sangju 37224, Republic of Korea

These authors contributed equally to this work.

To whom correspondence should be addressed : changsukong@gmail.com

© Copyright 2019, Korean Society of Poultry Science. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Mar 06, 2020; Revised: Mar 10, 2020; Accepted: Mar 10, 2020

Published Online: Mar 31, 2020

ABSTRACT

The present study determined the effect of dietary cultivated microalgae (Parachlorella sp.) on the growth and immune responses of pre-starter broilers. A total of 320 one-day-old birds (Ross 308) were allocated to 4 treatments with 8 blocks in a randomized complete block design. The four experimental diets consisted of a corn-soybean meal-based control diet, and three diets contained 0.5%, 1.0%, and 1.5% microalgae powder at the expense of cornstarch in the control diet. After feeding the experimental diets for 7 days, the body weight and feed intake of all birds were measured, and 8 birds were randomly selected from each treatment. Peripheral blood mononuclear cells (PBMCs) and serum were harvested for immune profile assessment, including cytokines and cell migration receptors. No differences in growth performance were observed among the treatments. The birds that were fed diets containing graded levels of microalga showed a linear increase in the mRNA expression of cytokine genes in PBMCs, including that of IL2, IL1β, and IL18 (P<0.05). With respect to the chemokine receptor genes in PBMCs, mRNA expression of CCR2, CCR9, and ITGA4 changed quadratically (P<0.05), but that of CCR7 increased linearly (P<0.01). Cytokine protein secretion in blood, including that of IL-1β and IL-6, increased linearly (P<0.01) with an increase in the microalgal content. Overall, the present results show that the indigenous microalgae powder used in this study could stimulate immunity with no detrimental effects on the growth performance of pre-starter broiler chickens.

Keywords: microalgae; Parachlorella sp.; growth performance; immune characteristics; broiler

서 론

미세조류는 강이나 바다, 호수, 연못에 서식하는 광합성 능력을 지닌 단세포 생물이다. 고효율의 광합성 기구(photosynthesis apparatus)를 통해 광에너지와 대기 중의 이산화탄소를 흡수하여 산소와 다양한 형태의 유기고분자물질을 생산한다. 전 세계적으로 약 20~30만 종이 존재할 정도로 종의 다양성이 높고, 육상식물이 생장하기 어려운 척박한 환경에서도 생존이 가능하다. 미세조류는 종이나 배양조건에 따라 탄수화물, 단백질, 지방의 구성 비율이 다르며, 베타카로틴(β-carotene)과 같은 카로테노이드(carotenoid) 계열 물질, 비타민, 토코페롤 등과 같은 유용물질을 다량 함유하고 있어 기능성 식품이나 사료첨가제 소재분야에서 활용성이 높다. 이러한 장점을 바탕으로 현재는 바이오에너지 생산, 폐수 및 중금속 처리, 생물비료, 식품 및 건강보조식품, 사료첨가제 등 다양한 생물산업 분야에 활용되고 있다(da Silva Vaz et al., 2016; Kim et al., 2016; Cho et al., 2017; Madeira et al., 2017).

kjps-47-1-49-g1
Fig. 1. Phylogenetic analysis of the 18S rDNA (a) and light microscopic photograph (b) of Parachlorella sp. (b). Scale bar=10 mm.
Download Original Figure

경제동물의 면역 연구는 대사성 질병 완화 및 병원성 미생물에 의한 감염을 줄이는 등 경제동물의 생산성과 직접적으로 관련이 있기 때문에 중요하다. 최근 장관면역 관련 연구에서는 장 상피세포가 숙주의 방어작용과 면역 항상성 유지에 기여한다고 보고되었다(Peterson et al., 2014). 또한, 최근 가금에서 미세조류를 활용한 연구에 따르면 닭의 특정 장 부위에서 감염을 일으켜 콕시듐증을 유발하는 Eimeria spp.를 육계에 감염시키고 베타-1,3-글루칸(1,3-β-glucan)이 포함된 미세조류를 사료에 첨가하여 급이하였을 때 육계의 장관면역과 숙주방어체계가 대조구에 비해 향상되었다고 보고되었다(Levine et al., 2018).

지속적인 세계 인구의 증가로 인한 경제동물의 동물성 단백질 공급 부족에 대응하여 미세조류는 양돈 및 양계사료용 첨가제로서의 활용이 요구되고 있으며(Świątkiewicz et al., 2015), 실제로 생산된 미세조류 중 30% 정도는 동물 사료첨가제로 판매되었다고 보고되었다(Becker, 2004). 사료내 미세조류의 첨가가 성장성 및 면역성에 미치는 효과는 축종 및 미세조류의 종류에 따라 차이를 보이며(Madeira et al. 2017), 가금류의 경우 효과가 두드러지게 나타나 미세조류의 사료적 가치 평가에 중요한 모델로 여겨진다(Becker, 2007).

산란계 사료내 미세조류 첨가는 난 생산성 향상과 난황색에 긍정적인 영향을 주며(Zahroojian et al., 2011), 육계 사료내 미세조류 첨가는 성장성 및 면역력에 긍정적인 영향을 미친다고 보고되었다(Rezvani et al., 2012; Kang et al., 2013). 그러나 현재까지 국내에서 생산된 미세조류의 육계 사료내 첨가 효과에 관한 연구는 부족한 실정이다. 따라서 본 실험은 낙동강 수계에서 분리한 토착 미세조류(Parachlorella sp.)의 초기 육계의 성장성 및 면역력에 미치는 효과를 확인하기 위하여 수행되었다.

재료 및 방법

1. 미세조류 분리, 배양 및 건조

본 연구에 사용된 미세조류를 분리하기 위해 경상북도 낙동강 상주보(36°26’02.6”N 128°14’54.3”E)에서 담수 시료를 확보하였다. 광학현미경 하에서 Pasteur pipette를 이용하여 담수 시료로부터 단일 미세조류 종을 분리하였다. ㈜코스모진텍(Seoul, Korea)에 18S rDNA sequencing 분석을 의뢰하여 종 동정을 실시하였다(Fig. 1).

배양배지는 미세조류 배양에 널리 사용되는 BG-11 배지를 사용하였다. 배지의 조성은 NaNO3 1.5 g/L, K2HPO4 0.04 g/L, MgSO4·7H2O 0.075 g/L, CaCl2·2H2O 0.036 g/L, Citric acid 0.06 g/L, Ferric ammonium citrate 0.06 g/L, EDTA(disodium magnesium salt) 0.01 g/L, Na2CO3 0.02 g/L, Trace-metal mix A5 (H3BO3 2.86 g, MnCl2·4H2O 1.81 g, ZnSO4·7H2O 0.22 g, Na2MoO4·2H2O 0.39 g, CuSO2·5H2O 0.079 g, Co(NO3)2·6H2O 0.0494 g/L)이며, 121°C, 1.5기압에서 15분간 멸균한 뒤 사용하였다.

Parachlorella 균체를 대량 배양하기 위해 100 L 평판형 광생물반응기(높이 1.7 m × 폭 0.7 m × 두께 0.1 m)를 사용하였다. 광생물반응기는 평판형태로 광투과도가 높은 Pyrex glass 재질로 제작되었으며, 통기(aeration)가 가능하도록 반응기 하부에서 미세 가스 공급기(sparger)를 설치했고, 5% 이산화탄소 가스가 함유된 공기를 0.1 vvm으로 주입하였다. 배양온도는 22±1°C로 설정하였으며, 광도의 경우 500 kW 백색(6,000K) LED 광패널 2기를 이용하여 300 μmol/m2/s를 연속적으로 공급하였다. 약 7~10일간 배양한 후 연속 원심분리기(J1250, Hanil Scientific Inc., Gimpo, Korea)를 이용하여 미세조류 균체를 회수한 뒤 동결건조(FD8512, Ilshinbiobase Co. Ltd., Dongducheon, Korea)를 진행하였다. 미세조류 배양에서 동결건조된 후 세포의 양(g)을 비율로 계산한 결과 회수율은 77.2±3.2%였다. 동결건조된 미세조류는 실험에 사용시까지 자동습도조절장치(KA33-73, Sanplatec Corp., Osaka, Japan)에 보관하였다.

2. 사양실험
1) 동물, 사료 및 실험설계

초생추인 육계(Ross 308) 수평아리 320수를 사용하여 부화 후 7일 동안 사양시험을 진행하였다. 시험기간동안 계사내 온도는 33°C를 유지해주었고, 습도는 40~50%가 되도록 유지시켜주었다. 점등은 시험기간 동안 24시간 연속 점등을 실시하였다. 시험에 사용된 사료는 옥수수-대두박 위주의 기초사료에 미세조류가 0%, 0.5%, 1.0% 및 1.5%가 첨가된 총 4종의 배합사료로 구성되었고(Table 1) 사료내 영양소 및 아미노산 함량 계산치에 대한 정보는 Table 2와 같았다. 사료내 미세조류 수준이 증가함에 따라 사료내 옥수수전분의 사용수준을 감소시켰다. 사료내 비타민 및 광물질 함량은 NRC(1994)에 제시되어 있는 요구량 추정치 이상이 되도록 배합하였다. 실험설계는 난괴법을 사용하여 실험개시일에 실험에 공시된 전체 병아리를 개별 인식표 부착 후 개별 체중을 기준으로 처리당 8개의 그룹으로 나뉘도록 구배치 프로그램(Experimental Animal Allotment Program; Kim, 2007)을 이용해 4처리 8반복 반복 당 10수씩 구배치했다.

2) 사료 급이 및 성장성 계산

육계는 전 실험기간 동안 배터리 케이지에서 그룹 사양하였고, 물과 사료는 무제한 급이하였다. 실험개시 후 7일째에 케이지별 체중을 측정해 실험사료 급이 기간에 따른 증체량을 계산하였고, 사료잔량을 수거 및 측정하여 실험사료 섭취량을 계산하였다.

3. 미세조류 첨가수준에 따른 면역지표 변화
1) 면역지표분석 방법
(1) 공시 재료 및 전처리

다양한 수준의 미세조류가 첨가된 사료를 1주일간 급이한 후 초기 육계의 혈액을 채취하여 미세조류 첨가가 혈액 내 면역세포에 미치는 영향을 quantitative real-time polymerase chain reaction(qRT-PCR)과 enzyme-linked immunosorbent assay(ELISA)를 통해 확인하였다. 육계의 혈액은 각 개체의 경동맥에서 채취하였다. 면역세포의 분리와 혈청 분리를 위해 EDTA blood collection tube와 SST blood collection tube(BD Biosciences, Franklin Lakes, NJ, USA)를 각각 사용하였다.

EDTA tube에 채취한 전혈을 Lymphoprep(STEMCELL Technologies, Vancouver, Canada)을 사용하여 PBMCs를 분리하였다. 육계의 전혈과 PBS(Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA)를 1:1의 비율로 희석한 후, 희석된 혈액을 분주된 Lymphoprep 층 위로 2:1의 비율로 분주하였다. 그 후 밀도구배 원심분리를 진행하여(800 ×g, 20분, 20°C, break off) PBMCs를 분리하였다. 분리된 PBMCs는 Trizol Reagent(Thermo Fisher Scientific Inc., Waltham, MA, USA)에 넣어 RNA 추출 전까지 −80°C에서 보관하였다. 혈청 분리를 위해 혈액을 SST tube에 채취한 후 원심분리(1,600 ×g, 15분, 4°C)하여 혈청을 분리한 후 분석 전까지 −20°C에서 보관하였다.

(2) RNA 추출 및 cDNA 합성

Trizol Reagent에 보관되어 있던 샘플로부터 RNA 추출을 진행하였다(Rio et al., 2010). RNA의 농도와 순도를 확인하기 위해서 NanoDrop ND-1000 Spectrophotometer(Thermo Scientific Inc., Wilmington, DE, USA)을 이용하여 농도와 순도를 확인한 다음 각 그룹별로 7개의 RNA를 분석에 사용하였다. 이후 AccuPower® RT PreMix(Bioneer, Daejeon, Korea)를 사용하여 제품 프로토콜에 따라서 cDNA를 합성하였다.

(3) qRT-PCR 분석

PBMC 내 주요 면역 관련 유전자의 발현을 비교하기 위해 qRT-PCR을 수행하였다. qRT-PCR을 수행하기 위해서 각각 해당 유전자의 primer들은 GeneBank에 제시된 염기서열로 Primer3 프로그램(http://primer3.ut.ee/)를 사용하여 제작하였다(Table 3). 그 후 유전자들의 상대적 발현량을 확인하기 위해서 BioRad CFX-96(Bio-Rad, Hercules, CA, USA)를 사용하여 qRT-PCR을 수행하였다. qRT-PCR 조건은 다음과 같이 진행하였다. 94°C에서 5분, 94°C에서 20초, 60°C에서 20초, 72°C에서 20초를 40 cycle 진행하고, 5분간 65~95°C Melting curve 분석을 진행하였다. 분석방법은 상대정량법으로 2−ΔΔCt method를 사용하였다(Livak et al., 2001). 유전자들의 상대적 발현량은 glyceraldehyde-3-phosphate dehydrogenase (GAPDH)를 이용하여 계산하였다.

Table 1. Ingredient and chemical compositions of experimental diets (as-fed basis, %)
Ingredient (%) Dietary microalgae concentration (%)
0 0.5 1.0 1.5
Corn 55.57 55.57 55.57 55.57
Soybean meal 36.71 36.71 36.71 36.71
Soybean oil 1.80 1.80 1.80 1.80
Microalgae 0.00 0.50 1.00 1.50
Cornstarch 1.50 1.00 0.50 0.00
Dicalcium phosphate 1.90 1.90 1.90 1.90
Limestone 0.45 0.45 0.45 0.45
Vitamin premix1 0.20 0.20 0.20 0.20
Mineral premix2 0.20 0.20 0.20 0.20
Choline chloride 0.09 0.09 0.09 0.09
L-Arg 0.13 0.13 0.13 0.13
L-Lys 0.31 0.31 0.31 0.31
L-Ile 0.06 0.06 0.06 0.06
L-Cys 0.14 0.14 0.14 0.14
DL-Met 0.25 0.25 0.25 0.25
L-Thr 0.20 0.20 0.20 0.20
L-Val 0.09 0.09 0.09 0.09
Salt 0.40 0.40 0.40 0.40
Total 100.00 100.00 100.00 100.00

Supplies the following per kilogram of diet: vitamin A, 24,000 IU; vitamin D3, 8,000 IU; vitamin E, 160 mg/kg; vitamin K3, 8 mg/kg; vitamin B1, 8 mg/kg; vitamin B2, 20 mg/kg; vitamin B6, 12 mg/kg; pantothenic acid, 40 mg/kg; folic acid, 4 mg/kg; niacin, 12 mg/kg.

Supplies the following per kilogram of diet: Fe, 120 mg/kg; Cu, 320 mg/kg; Zn, 200 mg/kg; Mn, 240 mg/kg; Co, 2 mg/kg; Se, 0.6 mg/kg; I, 2.5 mg/kg.

Download Excel Table
(4) ELISA 분석

ELISA는 Sandwich ELISA 방법을 사용하여 혈액 내 중요 사이토카인인 IL-1β와 IL-6의 농도를 조사하였다. ELISA 과정을 간략히 요약하면, immuno plate(SPL, Pocheon, Korea)에 capture antibody인 Rabbit anti chicken IL-1β (Bio-Rad, Hercules, CA, USA)와 Rabbit anti chicken IL-6 (Bio-Rad, Hercules, CA, USA)를 사용하여 4°C에서 16시간 이상 보관 후 다음날 washing buffer(0.05% Tween-20 in PBS)로 3회 세척 후 blocking buffer(1% BSA in PBS)를 1시간 동안 처리하였다. 3회 세척 이후 육계로부터 분리한 혈청을 적정 농도로 희석 후 plate에 분주하고 상온에서 2시간 정치하였다. 3회 세척 과정을 진행하고 detection antibody인 Goat anti Rabbit IgG(H/L): HRP(Bio-Rad, Hercules, CA, USA)를 분주하고 1시간 정치한 다음 stop solution(2N H2SO4)를 분주하여 반응을 중지시켰다. 그 후 흡광도를 측정하기 위해서 AMR-100 Microplate reader(Bioand, Namyangju, Korea)를 사용하여 450 nm의 파장에서 측정하여 육계 혈액내의 사이토카인의 양을 상대 정량하였다.

Table 2. Calculated nutrient and amino acid compositions (as-fed basis)
Item Dietary microalgae concentration (%)
0 0.5 1.0 1.5
Calculated value
AME1 (kcal/kg) 3006.5 3006.5 2965.8 2945.4
Crude protein (%) 23.00 23.00 23.00 23.00
Calcium (%) 0.96 0.96 0.96 0.96
Phosphorus (%) 0.48 0.48 0.48 0.48
Amino acids (%)
Arg 1.373 1.373 1.373 1.373
His 0.520 0.520 0.520 0.520
Ile 0.860 0.860 0.860 0.860
Leu 1.561 1.561 1.561 1.561
Lys 1.285 1.285 1.285 1.285
Met 0.518 0.518 0.518 0.518
Cys 0.446 0.446 0.446 0.446
Phe 0.932 0.932 0.932 0.932
Thr 0.865 0.865 0.865 0.865
Trp 0.236 0.236 0.236 0.236
Val 0.962 0.962 0.962 0.962

AME, apparent metabolizable energy.

Download Excel Table
Table 3. Primers used in this study
Genes Forward sequence Reverse sequence Size (bp) Annealing Tm (°C) Accession number
IL1β TCGACATCAACCAGAAGTGC GAGCTTGTAGCCCTTGATGC 185 60 NM_204524.1
IL2 TTGGCTGTATTTCGGTAGCA TCCTGGGTCTCAGTTGGTGT 163 60 NM_204153.1
IL6 CTCCTCGCCAATCTGAAGTC GGATTGTGCCCGAACTAAAA 164 60 NM_204628.1
IL17A GTGCCCATCAAACAGGAGAT GCTGTTAGGCAAGGCAGTTC 188 60 NM_204460.1
IL18 AGAGCATGGGAAAATGGTTG TCTTCCTCAAAGGCCAAGAA 168 60 NM_204608.1
IL22 TGGGTTGTCTTCTGCTGTTG AGGTGTAGGTGCGATTCCTG 154 60 NM_001199614.1
CCR2 CTGCCCATGACTGGATTTTT GGTGAGGATGCCGTAGGTAA 176 60 NM_001045835.1
CCR7 ACCAATGTGCCTGATGTGAA CTGATACGGCTGGAGAGGAG 185 60 NM_001198752.1
CCR9 GTGCCTCCCTGAGATCATGT TGGATGATCAGGGTGTAGCA 180 60 NM_001045840.1
ITGA4 TGCACCTGGAAGCTACTCCT CTTTTGGTGGTGCACTCCTT 164 60 XM_421974.6
GAPDH GTCCTCTCTGGCAAAGTCCAAG TCACAAGTTTCCCGTTCTCAGC 139 60 NM_204305.1
Download Excel Table
2) 통계분석

사료내 미세조류 첨가에 따른 성장성 및 면역지표 변화에 대한 결과의 통계 분석은 SAS 9.4(SAS, 2002)의 MIXED procedure를 이용하여 분산분석을 실시하였다. 통계 분석 시 고정효과는 실험 처리구였고, 체중에 따른 block은 임의효과로 설정하였다. 실험의 단위는 케이지(cage)로 하였다. 사료내 미세조류 첨가수준에 따른 성장성 및 면역지표의 변화는 직교다항대비(orthogonal polynomial contrast)를 통해 분석하였다. 모든 통계분석의 유의성은 0.05<P<0.1일 경우 경향이 있다고 판단하고, P<0.05일 경우 유의하다고 판단하였다.

결과 및 고찰

미세조류는 영양학적 가치가 높은 카로테노이드(carotenoids), 엽록소, 비타민 등이 함유되어 있어 오래 전부터 건강보조식품으로 사용되어 왔고, 최근에는 다양한 산업분야에서 활용되고 있다. Combs(1952)는 육계사료내 Chlorella 첨가가 양질의 영양소를 공급해주는 원료가 될 수 있을 것이라고 보고했다. 사료내 클로렐라의 첨가에 따른 육계의 성장(Kang et al., 2013), 면역 반응(An et al., 2016) 및 장내 미생물 균총의 변화에 긍정적인 영향에 대한 연구결과가 보고된 바 있다(Kang et al., 2013). 또한, 여러 축종(반추동물, 단위동물 및 토끼 등)에서 성장 증진 및 면역력 강화를 위한 사료첨가제로서 사용하기 위한 기초연구 및 자료조사가 활발히 진행 중이다(Madeira et al., 2017). 본 실험에서 사용한 미세조류(Parachlorella sp.)의 영양소 수준은 Chlorella vulgaris powder extract(Kang et al., 2013)와 비교했을 때 비슷한 단백질(59.3% vs. 60.6%) 수준을 보인 반면, 낮은 조섬유(2.91% vs. 13.0%)와 지방(1.05% vs. 12.8%) 함량을 갖는 것을 보였다(Table 4). 본 연구는 사료내 미세조류의 첨가수준에 따른 초기육계의 성장성과 면역반응에 대한 변화를 알아보기 위해 직교다항대비를 이용하였고, 사료내 미세조류 첨가량의 증가가 성장과 면역반응에 대해 선형 또는 2차 곡선적인 변화를 보이는지 확인하였다.

Table 4. Analyzed nutrient compositions of microalgae powder used in the current study (%, dry matter basis)
Item Microalgae
Crude protein 59.33
AEE1 1.05
Crude fiber 2.91
Ash 5.23
Phosphorus 0.88

AEE, acid-hydrolyzed ether extract.

Download Excel Table
1. 사료내 미세조류 급이에 따른 사양성적 변화

본 연구에서 사료내 미세조류 0.5~1.5%의 첨가는 초기 육계의 증체량, 사료섭취량, 사료효율 및 사료요구율에 영향을 미치지 않는 것으로 나타났다(Table 5). 현재까지 본 연구에 사용된 것과 동일한 미세조류를 육계 사료에 첨가한 연구는 전무하여 직접적인 비교는 어렵다. 하지만 다양한 미세조류를 사료에 첨가한 연구들에서 본 연구와 유사한 결과를 보여주었다. Petrolli et al.(2019)은 미세조류(Schizotrichium spp.)를 0.5~2.0% 첨가시킨 사료를 35일 동안 급이한 육계에서 증체량, 사료섭취량 및 사료요구율에 대한 미세조류의 영향은 나타나지 않은 것으로 보고하였다. 또한, Rezvani et al.(2012)은 육계사료내 Chlorella vulgaris를 0.07%, 0.14%, 및 0.21% 첨가하여 42일 동안 급이했을 때 실험 전 기간 동안 증체량에 영향을 미치지 않았다고 보고하였다. 하지만 본 연구의 결과와 상반되는 결과를 보고한 연구도 있었는데, Kang et al.(2013)은 1%의 Chlorella를 분말과 액체로 급이하였을 경우, 급이형태와 상관없이 육계의 성장이 미세조류의 첨가에 의해 개선되는 결과를 보고하였으며, Englmaierova et al.(2013)은 25~39주령 산란계 사료내 1.25%의 Chlorella sp. 첨가가 대조구에 비해 사료요구율을 감소시켜 개선된다고 보고하였다. 미세조류의 사료내 첨가가 가금의 성장에 미치는 영향이 상반되는 결과를 보여주는 것은 아마도 실험에 사용된 동물의 일령, 품종, 급이기간, 미세조류의 종류 등의 차이가 원인이었을 것이라고 사료된다(Madeira et al., 2017).

2. 사료내 미세조류 급이에 따른 면역지표 변화
1) PBMC 내 주요 사이토카인 유전자 발현 양상

사료 내 미세조류 첨가에 따른 육계 혈액 내 PBMC의 주요 사이토카인 발현 수준을 Table 6에 나타내었다. 본 연구에서 사료내 미세조류의 첨가는 혈액내 면역세포의 주요 사이토카인 유전자들의 발현량을 변화시켰다. 사이토카인은 주로 그들의 수용체에 따라서 type I family cytokine, type II family cytokine, IL-1 family cytokine family, IL-17 family cytokine 등으로 구분된다(Kawaguchi et al., 2004; Schwartz et al., 2016; Artlett, 2018). 본 연구에서는 type I family cytokine인 IL-2와 IL-6와 type II family cytokine인 IL-22, IL-1 family cytokine인 IL-1β와 IL-18, 마지막으로 IL-17 family cytokine인 IL-17A의 mRNA 발현 양상을 확인하였다.

Table 5. Weight gain, feed intake, gain to feed ratio, and feed conversion ratio of birds fed diets containing different concentrations of microalgae1
Item Dietary microalgae concentration (%) SEM P-value
0 0.5 1.0 1.5 Linear Quadratic
Weight gain (g/ for 7 d) 131 131 132 133 2.2 0.40 0.84
Feed intake (g/ for 7 d) 146 150 151 150 2.0 0.14 0.27
Gain to feed ratio (g/g) 0.90 0.88 0.88 0.89 0.017 0.75 0.33
Feed conversion ratio (g/g) 1.12 1.14 1.15 1.13 0.02 0.77 0.33

Each value represents mean of eight replicates per treatment.

Download Excel Table
Table 6. The effect of dietary microalgae concentration on the expression of cytokines in chicken peripheral blood mononuclear cells1
Item Dietary microalgae concentration (%) SEM P-value
0 0.5 1.0 1.5 ANOVA Linear Quadratic
IL2 1.0 5.9 9.5 15.9 4.17 0.09 0.01 0.86
IL6 1.0 2.7 17.5 7.7 4.34 0.04 0.08 0.19
IL22 1.0 4.2 14.4 5.3 2.73 0.01 0.06 0.03
IL1β 1.0 1.5 2.2 3.6 0.92 0.23 0.05 0.62
IL18 1.0 1.7 4.2 4.9 1.14 0.05 0.01 1.00
IL17A 1.0 4.2 11.1 5.3 2.43 0.04 0.08 0.07

Each value represents the relative gene expression of mean of seven replicates per treatment.

Download Excel Table

IL2IL6 유전자 발현량은 사료내 미세조류 첨가수준에 따라 각각 직선적(Linear; P=0.01) 증가 또는 직선적으로 변화하는 경향(Linear; P=0.08)을 보였다. 이 두 사이토카인은 주로 T 세포에서 분비되며, IL-6는 일부 단핵 식세포, 섬유아세포에서도 분비되기도 한다. 이들은 획득성 면역을 담당하는 T 세포와 B 세포의 분화 및 증식, 활성화를 통해서 면역반응을 유도한다(Feghali et al., 1997). 육계의 혈액 내 면역세포에서 확인한 type II family cytokine 유전자인 IL22의 발현량은 사료내 미세조류 첨가 수준이 증가함에 따라 곡선적인(Quadratic; P=0.06) 변화를 보였다. IL-22는 주로 Th17 세포에서 분비되는 사이토카인이며, 주로 장관에서 병원성 미생물에 대한 항균 펩타이드 생산과 감염부위로 호중구를 불러모으는데 관여한다. 또한 장상피세포의 증식과 세포사이에 밀착 연접단백질의 생산 등을 통해서 장관의 항상성 유지 및 완전성 등의 장관면역에 중요한 역할을 한다(Valeria et al., 2016).

IL-1 family cytokine인 IL1β(Linear; P=0.05)와 IL18(Linear; P=0.01)의 발현량은 사료내 미세조류 첨가수준이 증가함에 따라 직선적으로 증가하였다. 대식세포와 수지상세포 등의 항원제시세포에서 주로 분비되는 IL-1β와 IL-18은 염증조절복합체(inflammasome) 형성에 의해 분비가 유도되며, 박테리아 그리고 기생충, 프로토조아, 바이러스 등에 대한 다양한 숙주 방어체계에 관여한다(Yasuda et al., 2019). 또한, 두 사이토카인들은 장상피세포와 장내미생물간의 상호작용에 관여하여 장관면역의 항상성 유지 및 병원균 침투 저항성에 영향을 준다(Chudnovskiy et al., 2016; Chen 2017). 마지막으로 IL-17 family cytokine 유전자인 IL17A의 발현량은 사료내 미세조류 첨가 수준이 증가함에 따라 곡선적(Quadratic; P=0.07)으로 변화하는 경향을 보였다. T 세포 중의 한 종류인 Th17 세포에서 주로 분비되는 사이토카인인 IL-17A는 L. monocytogenes, Salmonella, Chlamydia 등의 병원성 미생물에 대한 숙주방어에 필수적인 면역 요인으로 알려져 있다(Li et al., 2018).

해당 연구에서 조사한 사이토카인들은 체면역뿐 아니라, 장관면역조절과 깊은 관련이 있다. 그러므로 추후 연구에서는 체면역을 넘어서 미세조류 급이에 따른 장관면역성상 변화에 대한 연구가 필요할 것이라 판단된다.

Table 7. The effect of dietary microalgae concentration on the level of cytokines in chicken blood1,2
Item Dietary microalgae concentration (%) SEM P-value
0 0.5 1.0 1.5 ANOVA Linear Quadratic
IL-1β 73.4 73.2 75.9 78.6 0.91 <0.01 <0.01 0.10
IL-6 55.6 57.1 60.8 61.5 1.14 <0.01 <0.01 0.73

Each value represents the relative protein secretion of mean of eight replicates per treatment.

The value of protein secretion of cytokine is calculated by percentage inhibition (PI) equation; PI = 100 − (Sample O.D value/Max O.D value) × 100.

Download Excel Table
2) 혈액 내 사이토카인 수준

사료 내 미세조류 첨가에 따른 육계 혈액 내 IL-1β와 IL-6의 수준을 ELISA 기법을 이용하여 비교하였으며, 이를 Table 7에 나타내었다. 분석 결과는 전반적으로 qRT-PCR 결과와 유사하였다. 혈액 내 IL-1β와 IL-6의 수준은 사료내 미세조류 첨가수준이 증가함에 따라 직선적으로 증가하였다(Linear; P<0.01). qRT-PCR을 통한 mRNA 발현 분석결과와 ELISA 분석 결과를 바탕으로 했을 때 사료내 미세조류 첨가는 초기 육계의 IL-1β와 IL-6 수준을 증가시키는 것으로 보인다. IL-1β와 IL-6는 대표적인 염증성 사이토카인들이며 간에서 선천성 면역의 한 종류인 급성기단백질(acute phase proteins)의 생산을 유도하여 감염성 미생물을 직접 죽이거나 면역반응을 조절한다(Zhou et al., 2016). 따라서 향후 선천성 면역과 관련된 혈액내 다른 사이토카인이나 단백질 수준에서의 연구와 미생물 감염과 면역조절물질의 기전이해에 대한 연구가 필요할 것으로 판단된다.

3) PBMC 내 세포이동 관련 수용체 유전자 발현 양상

사료내 미세조류 첨가에 따른 육계 혈액 내 PBMC의 주요 세포이동 관련 수용체 유전자 발현 수준 비교를 Table 8에 나타내었다. 케모카인 수용체와 인테그린 수용체는 특정 면역세포들이 동물 내 혈액에서 특정 조직으로 이동하는데 중요한 작용을 한다(Hughes et al., 2018). 이는 면역세포의 종류 및 활성도에 따라 다르게 나타나며 병원균 감염 부위로 면역세포가 효과적으로 이동하는데 필수적인 기전을 제공한다. 그러므로 본 연구에서 사료 내 수준별 미세조류 급이가 PBMC 내 주요 세포 이동 관련 수용체 유전자 발현에 미치는 영향을 조사하였다. 미세조류의 사료내 첨가는 CCR2, CCR7, CCR9ITGA4의 유전자 발현을 증가시키는 것을 본 연구에서 확인하였다. 육계 혈액내 면역세포의 CCR2 발현량은 사료내 미세조류 첨가수준이 증가함에 따라 곡선적(Quadratic; P=0.05)으로 변화함을 보였다. CCR2는 중요 면역세포 중 하나인 단핵구의 이동성(migration)에 중요한 역할을 하는 것으로 알려져 있다(Gautier et al., 2009). CCR7의 발현량은 사료내 미세조류 첨가수준이 증가함에 따라 직선적(Linear; P<0.01)으로 증가하는 것을 보였다. CCR7은 케모카인(CCL19, CCL21)의 주요 수용체로 T 세포와 수지상세포를 림프절 등의 림프조직으로 이동시키며, 림프조직에서 항체 반응 및 항원 특이적 T 세포 면역반응을 유도하는데 기여한다(Comerford et al., 2013). CCR9의 발현량은 사료내 미세조류 첨가수준의 증가에 따라 곡선적인(Quadratic; P=0.03) 변화를 보였다. CCR9은 케모카인 CCL25의 수용체로 소화장관의 면역항상성 유지와 밀접한 연관이 있다. CCL25는 최초로 발견된 점막 케모카인이며, 흉선과 소화장관에서 주로 발현되며, 골수로부터 흉선으로의 전구체 T 세포를 이동 및 발달에 중요한 역할을 한다. 특히 소화장관의 점막 상피세포에서 발현되며, 주요 림프구인 CCR9+ T 세포의 소화장관으로의 이동을 유도하며 그 밖에도 다른 림프구와 수지상세포에서도 발현된다(Hernández-Ruiz et al., 2017). 소화장관에 염증이 발생하였을 때, 염증부위에서는 CCL25의 발현과 CCR9+ T 세포의 수가 증가하게 되며, 조절 T 세포(Regulatory T cell, Treg)에 의해서 염증반응이 조절된다(Evans-Marin et al., 2015). 인테그린 수용체 유전자인 ITGA4의 유전자 발현량은 사료내 미세조류 첨가수준이 증가함에 따라 곡선적(Quadratic; P=0.03)으로 변화함을 보였다. ITGA4는 다양한 면역세포가 발현하는 인테그린 α4β7복합체에 포함되는 유전자로 소화장관으로 단핵구를 이동시키거나, 장관내의 장상피세포의 상처를 치유하는 등의 소화장관내의 항상성 유지에 중요한 역할을 한다고 알려져 있다(Schleier et al., 2020). 사이토카인을 포함한 세포 이동성 관련 수용체는 면역세포의 활성 및 종류에 따른 다른 수준의 발현 양상을 나타낸다. 그러므로 초기 육계 사료 내 미세조류의 첨가가 이러한 수용체들의 발현을 증가시킨 것은 미세조류 섭취가 육계의 혈액 내 면역세포 활성을 증진시켰거나, 혈액 내 면역세포 분포에 변화를 유도하였기 때문으로 보인다.

Table 8. The effect of dietary microalgae concentration on expression of cell migration receptors in chicken peripheral blood mononuclear cells1
Item Dietary microalgae concentration (%) SEM P-value
0 0.5 1.0 1.5 ANOVA Linear Quadratic
CCR2 1.1 3.9 14.9 1.4 4.08 0.07 0.52 0.05
CCR7 1.1 6.4 10.7 10.4 2.19 0.01 <0.01 0.20
CCR9 1.1 18.0 61.9 13.6 14.19 0.02 0.21 0.03
ITGA4 1.0 6.0 4.4 2.9 1.43 0.10 0.52 0.03

Each value represents the relative gene expression of mean of seven replicates per treatment.

Download Excel Table

해당 연구에서 조사한 육계 혈액내 면역반응들은 병원성 미생물 같은 감염성 질병 요인들에 대항하는데 중요한 요인들이다. 또한, 전체 면역체계 중에서 대부분을 차지하고 있는 장관면역을 다양한 방식으로 조절하는 면역 요인들이기도 하다. 연구결과를 통해서 초기 육계 사료내 적정 수준의 미세조류 첨가는 육계의 면역체계 발달을 촉진하거나, 면역반응을 자극할 가능성이 있는 것으로 보인다. 하지만 초기 육계의 혈액 내 면역반응은 다양한 환경요인에 영향을 받으므로 사료내 미세조류 첨가가 육계 면역에 미치는 영향을 정확히 이해하기 위해서는 가장 먼저 미세조류에 포함된 유용한 성분들을 분석하여 미세조류 내 특정 기능성 물질의 면역기능 조절성에 대한 이해가 필요하다. 또한, 향후에는 유세포분석기를 이용한 육계의 혈액 및 소화장관 내 면역세포의 분포나 기능적 특성 조사가 필요할 것으로 생각된다. 또한, 미세조류 첨가에 따른 면역변화를 확인하기 위해 분리된 면역세포에 Lipopolysaccharide 등의 항원에 반응성을 비교하는 In vitro 연구와 초기 육계에 미세조류가 포함된 사료 급이 시에 특정 항원 자극 모델을 통해 특이적 면역반응을 확인하는 In vivo 연구와 같은 보다 세밀한 연구가 필요할 것으로 보인다.

결 론

본 실험의 결과, 초기 육계 사료내 0.5~1.5%의 토착미세조류(Parachlorella sp.) 첨가는 초기 육계의 성장성에는 영향을 미치지 않았지만, 혈액 내 PBMC에서 일부 사이토카인과 주요 세포이동 관련 수용체 유전자의 발현을 증가시켰다. 따라서 이러한 미세조류의 닭 사료 내 첨가는 육계의 면역을 직접적 또는 간접적으로 조절하여 닭 건강 증진용 사료첨가제로의 활용이 가능성이 있을 것으로 사료된다.

사 사

본 연구는 환경부의 재원으로 국립낙동강생물자원관에서의 지원(NNIBR202002103)과 2018학년도 부산대학교 신임교수연구 정착금 지원을 받아 수행된 연구입니다.

REFERENCES

1.

An BK, Jeon JY, Kang CW, Kim JM, Hwang JK 2014 The tissue distribution of lutein in laying hens fed lutein fortified Chlorella and production of chicken eggs enriched with lutein. Korean J Food Sci 34(2):172-177.
, ,

2.

An BK, Kim KE, Jeon JY, Lee KW 2016 Effect of dried Chlorella vulgaris and Chlorella growth factor on growth performance, meat qualities and humoral immune responses in broiler chickens. Springerplus 5(1):718.
, ,

3.

Artlett CM 2018 The IL-1 family of cytokines. Do they have a role in scleroderma fibrosis? Immunol Lett 195(3): 30-37.
,

4.

Becker EW 2007 Micro-algae as a source of protein. Biotechnol Adv 25(2):207-210.
,

5.

Becker W 2004 Microalgae in human and animal nutrition. Pages 312-352 In: Handbook of Microalgal Culture: Biotechnology and Applied Phycology. Blackwell Science, UK.

6.

Belay A, Kato T, Ota Y 1996 Spirulina (Arthrospira): potential application as an animal feed supplement. J Appl Phycol 8:303-311.

7.

Chen GY 2017 Regulation of the gut microbiome by inflammasomes. Free Radical Bio Med 105(4):35-40.
, ,

8.

Cho DH, Choi JW, Kang Z, Kim BH, Oh HM, Kim HS, Ramanan R 2017 Microalgal diversity fosters stable biomass productivity in open ponds treating wastewater. Sci Rep 7(1):1-11.
, ,

9.

Chudnovskiy A, Mortha A, Kana V, Kennard A, Ramirez JD, Rahman A, Amir EAD 2016 Host-protozoan interactions protect from mucosal infections through activation of the inflammasome. Cell 167(2):444-456.
, ,

10.

Combs GF 1952 Algae (Chlorella) as a source of nutrients for the chick. Science 116(3017):453-454.
,

11.

Comerford I, Harata-Lee Y, Bunting MD, Gregor C, Kara EE, McColl SR 2013 A myriad of functions and complex regulation of the CCR7/CCL19/CCL21 chemokine axis in the adaptive immune system. Cytokine Growth Factor Rev 24(3):269-283.
,

12.

da Silva Vaz B, Moreira JB, de Morais MG, Costa JAV 2016 Microalgae as a new source of bioactive compounds in food supplements. Curr Opin Food Sci 7(1):73-77.

13.

Evans-Marin HL, Cao AT, Yao S, Chen F, He C, Liu H, Cong Y 2015 Unexpected regulatory role of CCR9 in regulatory T cell development. PLoS One 10(7): e0134100.
, ,

14.

Feghali CA, Wright TM 1997 Cytokines in acute and chronic inflammation. Front Biosci 2(1):d12-d26.
,

15.

Gautier EL, Jakubzick C, Randolph GJ 2009 Regulation of the migration and survival of monocyte subsets by chemokine receptors and its relevance to atherosclerosis. Arterioscler Thromb Vasc Biol 29(10):1412-1418.
, ,

16.

Halle I, Janczyk P, Freyer G, Souffrant WB 2009 Effect of microalgae Chlorella vulgaris on laying hen performance. Arch Zootech 12(2):5-13.

17.

Hernández-Ruiz M, Zlotnik A 2017 Mucosal chemokines. J Interferon Cytokine Res 37(2):62-70.
, ,

18.

Hughes CE, Nibbs RJ 2018 A guide to chemokines and their receptors. FEBS J 285(16):2944-2971.
, ,

19.

Kang HK, Salim HM, Akter N, Kim DW, Kim JH, Bang HT, Na JC, Hwangbo J, Choi HC, Kim MJ, Suh OS 2013 Effect of various forms of dietary chlorella supplementation on growth performance, immune characteristics, and intestinal microflora population of broiler chickens. J Appl Poult Res 22(1):100-108.

20.

Kawaguchi M, Adachi M, Oda N, Kokubu F, Huang SK 2004 IL-17 cytokine family. J Allergy Clin Immunol 114(6):1265-1273.
,

21.

Kim BG, Lindemann MD 2007 A spreadsheet method for experimental animal allotment. J Anim Sci 85(Suppl. 2):112.

22.

Kim YJ, Kwon S, Kim MK 2009 Effect of Chlorella vulgaris intake on cadmium detoxification in rats fed cadmium. Nutr Res Pract 3(2):89-94.
, ,

23.

Kim ZH, Park H, Lee CG 2016 Seasonal assessment of biomass and fatty acid productivity by Tetraselmis sp. in the ocean using semi-permeable membrane photobioreactors. J Microbiol Biotechnol 26(6):1098-1102.
,

24.

Levine R, Horst G, Tonda R, Lumpkins B, Mathis G 2018 Evaluation of the effects of feeding dried algae containing beta-1,3-glucan on broilers challenged with Eimeria. Poult Sci 97(10):3494-3500.
,

25.

Li Y, Wei C, Xu H, Jia J, Wei Z, Guo R, Li Z 2018 The immunoregulation of Th17 in host against intracellular bacterial infection. Mediat Inflamm 2018:ID 6587296.
, ,

26.

Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25(4):402-408.
,

27.

Madeira MS, Cardoso C, Lopes PA, Coelho D, Afonso C, Bandarra NM, Prates JAM 2017 Microalgae as feed ingredients for livestock production and meat quality: a review. Livest Sci 205:111-121.

28.

National Research Council 1994 Nutrient Requirements of Poultry: Ninth Revised Edition, 1994. The National Academies Press, Washington, DC.

29.

Peterson LW, Artis D 2014 Intestinal epithelial cells: regulators of barrier function and immune homeostasis. Nat Rev Immunol 14(3):141-153.
,

30.

Petrolli TG, Petrolli OJ, Pereira ASC, Zotti CA, Romani J, Villani R, Leite F, Zanandréa, FM 2019 Effects of the dietary supplementation with a microalga extract on broiler performance and fatty acid meat profile. Braz J Poultry Sci 21(3):001-008.

31.

Rezvani M, Zaghari M, Moravej H 2012 A survey on Chlorella vulgaris effect’s on performance and cellular immunity in broilers. IJASR 3(1):9-15.

32.

Rio DC, Ares M, Hannon GJ, Nilsen TW 2010 Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc 2010(6):pdb-prot5439.
,

33.

Schleier L, Wiendl M, Heidbreder K, Binder MT, Atreya R, Rath T, Ullrich K 2020 Non-classical monocyte homing to the gut via α4β7 integrin mediates macrophagedependent intestinal wound healing. Gut 69(2):252-263.
,

34.

Schwartz DM, Bonelli M, Gadina M, O’shea JJ 2016 Type I/II cytokines, JAKs, and new strategies for treating autoimmune diseases. Nat Reviews Rheumatol 12(1):25.
, ,

35.

Świątkiewicz S, Arczewska-Włosek A, Józefiak D 2015 Application of microalgae biomass in poultry nutrition. Worlds Poult Sci J 71(4):663-672.

36.

Valeri M, Raffatellu M 2016 Cytokines IL-17 and IL-22 in the host response to infection. Pathog Dis 74(9):ftw111.
, ,

37.

Yasuda K, Nakanishi K, Tsutsui H 2019 Interleukin-18 in health and disease. Int J Mol Sci 20(3):649.
, ,

38.

Zahroojian N, Moravej H, Shivazad M 2011 Comparison of marine algae (Spirulina platensis) and synthetic pigment in enhancing egg yolk colour of laying hens. Br Poult Sci 52(5):584-588.
,

39.

Zhou Z, Xu MJ, Gao B 2016 Hepatocytes: a key cell type for innate immunity. Cell Mol Immunol 13(3):301-315.
, ,