Article

토종 종계의 암수 합사가 개체의 스트레스 반응 정도에 미치는 영향

정현철1https://orcid.org/0000-0002-2415-9353, 최은식1https://orcid.org/0000-0002-5169-7034, 권재현1https://orcid.org/0000-0001-6084-828X, 조은정2https://orcid.org/0000-0003-1416-0884, 손시환3,https://orcid.org/0000-0001-6735-9761
Hyeon Cheol Jeong1https://orcid.org/0000-0002-2415-9353, Eun Sik Choi1https://orcid.org/0000-0002-5169-7034, Jae Hyun Kwon1https://orcid.org/0000-0001-6084-828X, Eun Jung Cho2https://orcid.org/0000-0003-1416-0884, Sea Hwan Sohn3,https://orcid.org/0000-0001-6735-9761
Author Information & Copyright
1경남과학기술대학교 동물생명과학과 대학원생
2경남과학기술대학교 동물생명과학과 연구원
3경남과학기술대학교 동물생명과학과 교수
1Graduate Student, Department of Animal Science and Biotechnology, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korea
2Researcher, Department of Animal Science and Biotechnology, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korean
3Professor, Department of Animal Science and Biotechnology, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korea
To whom correspondence should be addressed : shsohn@gntech.ac.kr

© Copyright 2019, Korean Society of Poultry Science. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Feb 04, 2020; Revised: Feb 18, 2020; Accepted: Feb 19, 2020

Published Online: Mar 31, 2020

적 요

본 연구는 한국토종닭 종계에 있어 암수 합사가 개체들의 스트레스 반응 정도에 미치는 영향을 살펴보고자 한 것으로 스트레스 반응 정도는 합사 이전과 합사 이후 개체들의 H/L ratio, HSPs 유전자 발현량 및 세포 내 DNA 손상율을 분석하였다. 분석 결과, 합사에 따른 개체들의 H/L ratio 값이 합사 이전에 비해 3배 이상 유의하게 증가한 것으로 나타났으며 암수 간 차이는 없는 것으로 나타났다(P<0.001). HSP-70, HSP90-α 및 HSP90-β 유전자 발현율에 있어 모든 HSPs의 유전자 발현율이 암수 합사 이전에 비해 합사 이후 2.5~3.4배 정도 유의하게 상승한 것으로 나타났으며, 특히 암컷이 수컷에 비해 합사에 따른 HSPs 발현율 증가가 높은 것으로 나타났다(P<0.01). 세포 내 DNA 손상율 분석에 있어 모든 Comet 지표들이 암수 합사 이전에 비해 합사 이후에 유의하게 증가하였으며, 암수 간에는 차이가 없는 것으로 나타났다(P<0.001). 이상의 결과들을 종합할 때, 토종 종계에 있어 암수 합사가 암컷과 수컷 모두에게 매우 큰 외적 스트레스 요인으로 작용함을 시사한다고 하겠다.

ABSTRACT

This study was performed to investigate the effect of mixed rearing of male and female chickens on the stress response in Korean native chickens. To identify the degree of the stress response, heterophil-lymphocyte ratio (H/L ratio), heat shock protein genes (HSPs) expression, and intracellular nuclear DNA damage rate were analyzed before and after the mixed rearing of male and female chickens. The results showed that the H/L ratio of chickens after mixing males and females was more than thrice as higher than before mixing (P<0.001), but the differences between males and females were not significant. HSP-70, HSP90-α, and HSP90-β expression levels were 2.5 to 3.4 times higher after mixing male and female chickens, compared to before mixing (P<0.01). In the mixed rearing of male and female chickens, the increase in HSPs expression in females was higher than in males. Comet indicators in intracellular DNA damage rate analysis showed a significant increase after mixing male and female chickens compared to before mixing (P<0.001). However, there was no significant difference between males and females with respect to DNA damage rate. Taken together, these results suggest that male and female mixed rearing acts as a strong external stressor in both male and female chickens.

Keywords: 한국토종닭; 암수합사; 스트레스 반응; H/L 비율; 열충격단백질; DNA 손상율
Keywords: Korean native chicken; male-female mixed rearing; stress response; H/L ratio; HSP; DNA damage rate

서 론

종계 산업에서 가장 중요하게 고려되는 사항은 경제성과 생산성으로 종계의 생산 효율을 높이기 위하여 다양한 사육 방법들이 소개되고 있다. 현재 종계의 사육 방식은 크게 암수를 분리 사육하면서 인공수정에 의해 종란을 생산하거나, 성 성숙 이후 선발된 수탉을 암컷 집단에 합사시켜 종란을 얻고 있다. 따라서 종계의 암수 분리 사육과 혼합 사육 간 경제성과 생산성에 대한 비교 분석도 생산 효율의 증대를 위해 연구할 필요가 있다. 지난 수 많은 연구들을 통하여 닭은 수컷과 암컷 간의 발육 양상이 다르고, 수컷이 암컷에 비해 성장률이 높으며, 사료섭취량 및 사료요구율에서도 현격한 차이를 보여 암수 분리 사육이 사양관리 및 생산적 측면에서 보다 많은 이점이 있다고 보고하였다(Gous et al., 1999; May and Lott, 2001; Da Costa et al., 2017; Oh et al., 2019). 또한 암수 혼합 사육의 경우, 암수 간의 급이경쟁을 유발하고 과도한 교미행위 등으로 인하여 폐사율이 증가하고 생산효율이 감소한다고 알려져 있다(Son, 2010; Son et al., 2010; Mphepya et al., 2019). 그럼에도 불구하고 아직 국내 많은 중소형 종계장의 경우, 인건비 절감 및 사육관리의 간편성 등의 이유로 암수 합사를 선호하고 있다. 더불어 최근 동물 복지 및 친환경 사육 방식이 요구되면서 암수 혼합 사육은 더욱 증가되고 있는 추세이다. 따라서 닭의 생산성과는 별개로 동물 복지적 관점에서 암수를 합사하였을 경우 합사 이전과 합사 이후 개체들의 생리적 반응의 변화 정도를 살펴볼 필요가 있다. 닭은 외부 스트레스에 매우 민감한 동물로 알려져 있으며, 스트레스를 받을 경우 면역력 감소 등으로 인해 생산력이 감소하고, 폐사율이 증가한다고 한다(Puvadolpirod and Thaxton, 2000; Kang et al., 2013; Cho et al., 2019). 특히 사육 밀도나 사육 형태에 따른 닭의 스트레스 반응 정도의 차이가 매우 크다고 알려져 있으나(Beloor et al., 2010; Sohn et al., 2011, 2012) 사육 방법 중 암수 합사 형태가 개체에 미치는 스트레스 반응 정도에 대해서는 아직 보고된 바가 없다. 닭의 스트레스 반응 정도를 측정하기 위한 대표적인 생물학적 표지로는 heterophil-lymphocyte의 비율(H/L ratio)과 혈장 코르티코스테론 수준(Mashaly et al., 1984; McFalane and Curtis, 1989; Vleck et al., 2000; Zulkifli et al., 2000; Soleimani et al., 2011) 및 열 충격 단백질(Heat Shock Proteins; HSPs) 발현량 등이 있다(Gornati et al., 2004; Zulkifli et al., 2009; Beloor et al., 2010; Sohn et al., 2012; Cho et al., 2019). 이와 더불어 스트레스를 받게 되면 체내 활성산소가 증가하게 되는데 과도한 활성산소는 생체 산화 균형을 무너뜨려 세포 내 DNA 손상을 증가시킴으로 DNA 손상율 또한 좋은 스트레스 측정지표로 사료된다(Singh et al., 1988; Nandhakumar et al., 2011; Sohn et al., 2012). 따라서 본 연구에서는 한국토종닭 종계에 있어 암수 합사가 개체들의 스트레스 반응 정도에 미치는 영향을 살펴보고자 합사 이전과 이후의 개체들 간의 H/L ratio, HSPs 발현량 및 세포 내 DNA 손상율을 비교 분석하였다.

재료 및 방법

1. 공시동물 및 사육 방법

닭의 암수 합사가 개체의 스트레스 반응 정도에 미치는 영향을 살펴보기 위하여 한협원종이 보유하고 있는 토종종계(PS) 4개 조합(FH, HF, FY, HY) 854수를 공시 대상으로 하였다. 발생 직후 평균 34 g 전후의 초생추들을 경남과학기술대학교 종합농장으로 이송하여 육추, 육성 및 산란기 동안 사육하였다. 발생후 14주령까지의 사양관리는 강제 환기 및 자동온도조절 시스템이 완비된 육추사 내 3단 2열 배터리형 케이지(74 cm × 60 cm × 35 cm)에서 암수 분리하여 케이지 당 10수씩 배치하여 사육하였다. 14주령 이후 무창형 종계사로 이송한 후 2단 4열 군사케이지(90 cm × 90 cm × 71 cm)에서 37주령까지 암수 분리하여 케이지 당 10수씩 사육하였고, 이후 한 케이지 당 암컷 8수와 수컷 2수로 합사하여 재배치하였다. 공시계들의 사료 급여는 시중 배합사료를 이용하여 제한급여를 실시하였고, 점등관리는 점감점증하여 24주령에 총 17시간으로 고정하였다. 백신 접종 등 기타 사양관리는 한협원종의 종계 사양관리지침에 따라 수행하였고, 시험에 관련된 닭의 관리 및 취급은 본 대학 동물실험윤리위원회의 승인(IACUC, approved no. 2019-14)을 득한 후 본 규정을 준수하여 시행하였다. 암수 합사에 따른 개체들의 스트레스 반응 정도를 분석하기 위하여 합사 이전인 37주령 때와 합사 후 2주가 경과한 39주령 때 케이지 별 무작위로 암수 95수를 선정하고 동일 개체로부터 혈액을 채취하였다.

2. Heterophil/Lymphocyte의 비율 분석

개체의 heterophil/lymphocyte의 비율(H/L ratio) 측정을 위하여 시험계 95수 전체를 대상으로 37주령 및 39주령 때 각 개체의 익 정맥으로부터 혈액을 채취하고, 이들 혈액내 비율을 분석하였다. 표본 제작은 슬라이드 상에 혈액 1방울을 도말 후 건조시키고, 메탄올로서 고정하였다. 염색은 25% Giemsa stain solution(Sigma Chem., St Louis, MO, USA)으로 5분간 처리하였다. 염색 후 건조된 슬라이드는 광학현미경(Model BX-50, Olympus, Tokyo, Japan)을 통하여 상을 관찰하고(obj. ×40) 표본 cm2 당 heterophil과 lymphocyte 수를 측정하였다.

3. Heat Shock Proteins 유전자 발현율 분석

HSPs 유전자 발현율 분석을 위하여 시험계 중 암수 각 20수씩을 대상으로 혈액으로부터 RNA를 추출한 후 cDNA를 합성하였다. HSP-70, HSP90-α 및 HSP90-β 유전자 발현율 분석을 위한 Real-time PCR의 primers는 Table 1과 같다. Quantitative PCR은 real-time PCR machine(Model LC480, Roche, Mannheim, Germany)을 이용하여 cDNA 2 μL(50 ng/μL), primer(5 pmol/μL) 각각 0.5 μL, SYBR Green(Roche, GmbH, Mannheim, Germany) 10 μL, ddH2O 7 μL를 넣어 최종 volume이 20 μL가 되도록 하고, 95°C에서 5분간 최초 변성시킨 후 95°C 10초 변성, 60°C 30초 접합, 72°C 10초간 신장 반응을 60회 반복하면서 진행 중 실시간 형광 모니터링 하였다. Tm값의 측정은 LightCycler® 480 software v1.5 (Roche Diagnostics, GmbH, Mannheim, Germany)를 이용하여 분석하였다. Reference gene을 이용한 각 표적유전자의 상대적 정량값은 Livak and Schmittgen(2001)이 제시한 2−ΔΔCt 방법으로 분석하였다.

4. DNA 손상율 분석

DNA 손상율 분석을 위해 시험계 중 암수 각 40수에 대해 Comet assay를 실시하였다. Comet assay 표본 제작을 위해 Histopaque(Sigma Chem)을 이용하여 혈액으로부터 순수 백혈구를 분리하였다. Comet assay를 위한 표본은 1% agarose로 coating된 슬라이드 위에 백혈구와 0.5% low melting point agarose(LMPA)를 1:7.5로 혼합한 용액을 떨어뜨려 냉동 건조 후 제작하였다. 표본은 1% LMPA로 도포한 후 재 냉동 건조하고, 4°C lysis solution(2.5 M NaCl, 100 mM disodium EDTA, 10 mM Trizma base)에 60분간 침지한 다음 25 V, 300 mA로 30분간 전기영동 하였다. 처리를 마친 슬라이드는 neutralization buffer(0.4 M Tris-HCl)로 3회 세척한 후 ddH2O와 70% 에탄올로 탈수하였다. 건조된 슬라이드는 propidium iodide solution(Sigma Chem)으로 염색하고, 형광현미경(Model DP-70, Olympus, Tokyo, Japan)으로 관찰하였다. 관측된 상은 개체 별 50개의 세포를 대상으로 Comet Score software 1.5(TriTek Corp. Sumerduck, VA, USA)로 분석하였다. 분석 항목으로는 tail 내 DNA 함유율(% DNA in tail), tail 내 DNA 생성률(tail moment) 및 올리브 모먼트(olive moment)를 조사하였다.

Table 1. The primers of HSPs for the quantitative real-time PCR
Genes Primer Sequence(5’-3’) Size (bp) Tm (°C)
RPL27 Forward GCGCATTGGAGCGGCTGTGT 81 60
Reverse CCTTCCGTGGGTAGCGGTCG
HSP-70 Forward TCCTCTGCTTTGTATTTCTCTG 145 60
Reverse ATGCTAATGGTATCCTGAACG
HSP-90α Forward GGAGAAGTTACCAAGCGATT 133 60
Reverse CAGAAGATGAAGAAGAGAAGAAGA
HSP-90β Forward GCAGGACAGTAGGTGAGT 113 60
Reverse GAGGCAGAGCAAGATGAAG
Download Excel Table
5. 통계분석

시험구 간의 H/L ratio, DNA 손상율 및 HSPs 유전자 발현율의 통계 모형은 암수 및 합사 전후 요인에 대한 2 × 2 요인시험으로 설계하였고, 처리 별 각 개체를 실험단위로 하였다. 통계 분석은 SAS 통계패키지(SAS Institute Inc., Cary, NC, USA)의 GLM procedure를 이용하여 요인 간 차이 및 이들 간 상호 작용에 대해 유의성을 검정하였다. 처리 별 시험구 간의 유의한 차이가 인정될 경우 동일 패키지의 Tukey’s HSD procedure로 각 평균값들 간의 유의성을 검정하였다.

결과 및 고찰

1. 암수 합사 개체들의 Heterophil/Lymphocyte의 비율

토종 종계의 암수 합사가 개체의 스트레스 반응 정도에 미치는 영향을 분석하기 위해 스트레스 반응 지표 중 하나인 H/L ratio를 분석하고 이의 분석 결과를 Table 2에 제시하였다. 공시계들의 혈액 내 heterophil과 lymphocyte의 분포 양상은 Fig. 1과 같다. 시험은 암수 합사 이전인 37주령과 합사 후 2주째인 39주령 때 동일한 개체의 혈액을 채취하여 H/L ratio를 측정하고 측정치들을 합사 및 암수에 따른 요인 분석을 하였다. 분석 결과, 암수 합사 이전과 이후 H/L ratio값 간의 유의한 차이를 보이며(P<0.001), 합사 이후 개체들의 H/L ratio 값이 합사 이전에 비해 3배 이상 증가한 것으로 나타났다. 암수 합사에 따른 H/L ratio값은 유의하게 상승하였지만 암수 간의 차이는 없는 것으로 나타났고, 합사와 암수 요인 간 상호작용 효과도 없는 것으로 나타났다. H/L ratio는 heterophil과 lymphocyte의 비율로 스트레스 반응 정도를 간접적으로 나타내는 지표이다. 닭을 포함한 다양한 조류들에서 외적 스트레스가 증가하면 혈액 내 heterophil의 수가 증가하고, 반면 lymphocyte의 수는 감소하게 된다(Gross and Siegel, 1983; Gross, 1989; McFarlane and Curtis, 1989). 일반적으로 lymphocyte 수의 변화는 corticosterone의 함량 변화보다 완만하게 반응하고 변이가 적으며, 지속적으로 작용함으로 corticosterone 함량을 이용한 스트레스 지표보다 훨씬 안정된 지표라 제시하고 있다(Cunnick et al., 1994; McKee and Harrison, 1995; Vleck et al., 2000; Cotter, 2015). 닭에 있어 외적 스트레스 요인으로 비정상적인 사육 온도나 밀사된 사육 시설이 H/L ratio 값을 증가시킨다고 보고한(Campo et al., 2007; Cotter, 2015) 반면, 비타민 C와 같은 항산화제의 급여는 닭의 스트레스 반응을 저하시켜 H/L ratio 값이 감소된다는 결과를 제시하였다(Zulkifli et al., 2000). 따라서 본 연구 결과, 암수 합사가 암컷과 수컷에서 공히 H/L ratio 값을 증가시킴으로 합사가 닭에 있어 매우 큰 외적 스트레스 요인임을 시사한다.

kjps-47-1-29-g1
Fig. 1. Heterophils and lymphocytes in Korean native chicken blood. The values of H/L ratio are 0.2(a), 0.63(b), 0.89(c), and 1.11(d).
Download Original Figure
kjps-47-1-29-g2
Fig. 2. The patterns of DNA migration by comet assay in Korean native chicken lymphocytes. The values of % DNA in tail are 11.58(a), 35.52(b), 50.49(c), and 94.38(d).
Download Original Figure
2. 암수 합사 개체들의 HSPs 유전자 발현율

암수 합사 개체들의 스트레스 반응 정도를 알기 위하여 HSP-70, HSP90-α 및 HSP90-β 유전자 발현율을 분석하고, 이의 결과를 Table 3에 제시하였다. 분석 결과, 모든 HSPs의 유전자 발현율이 암수 합사 이전에 비해 합사 이후 2.5~3.4배 정도 유의하게 상승한 것으로 나타났으며(P<0.01), HSPs 간 발현율의 변화 정도도 거의 비슷한 양상을 나타내었다. 특히 암컷이 수컷에 비해 합사에 따른 HSPs 발현율 증가가 컸으며, 동일 환경에서 암수 간의 차이는 없는 것으로 나타났다. 열 충격 단백질(heat shock proteins)들은 열 스트레스에 반응하여 합성되는 특이 단백질들로서 열 스트레스뿐만 아니라 주변의 외적 스트레스 정도가 높아지면 개체의 HSPs의 발현율이 증가하게 된다(Lindquist, 1986; Schlesinger, 1990). 닭에 있어서도 고온 스트레스뿐만 아니라, 제한 급여, 수송, 격리, 밀집 사육과 같은 외적 스트레스가 가해졌을 때 HSPs의 발현율이 현저하게 상승하였다고 보고함으로 HSPs의 발현량이 닭의 스트레스 정도를 가늠할 수 있는 간접적 스트레스 지표라 하겠다(Beloor et al., 2010; Sohn et al., 2012; Kamboh et al., 2013, Cho et al., 2019). 많은 동물들에서 고온 스트레스에 노출되면 대부분의 단백질의 합성이 저해되지만 HSP와 같은 특정 단백질군은 합성이 촉진된다. 이들은 스트레스에 노출된 세포에서 열 민감 단백질과 결합하여 세포 퇴행을 억제하는 역할을 한다(Schlesinger, 1990). 따라서 HSPs 발현율 증가는 스트레스 노출의 결과로 해석될 수 있다. 연구자에 따라 닭의 경우, HSP군 중 HSP-70이 열 스트레스에 가장 민감하게 작용한다고 보고한 반면(Zulkifli et al., 2002; Soleimani et al., 2011), HSP90-α와 달리 HSP90-β는 조류에서 열 스트레스에 거의 반응하지 않는 단백질이라 보고하기도 하고(Meng et al., 1993), 밀사와 절식과 같은 스트레스 환경하에서는 HSPs들 중 특히 HSP90-α가 유의한 증가 양상을 보인다고 하였다(Sohn et al., 2012). 이러한 결과들과 달리 본 연구에서는 닭의 암수 합사에 따라 개체의 HSP-70, HSP90-α 및 HSP90-β 모든 유전자의 발현율이 현저히 증가됨으로 암수 합사가 닭에 있어 매우 큰 스트레스 요인임을 시사한다고 하겠다.

Table 2. Expressions of HSP genes before and after mixed rearing of male and female chickens in Korean native chicken
Rearing Sex n H/L ratio
Before mixed rearing Female 44 0.33±0.17b
Male 41 0.35±0.22b
After mixed rearing Female 40 0.99±0.40a
Male 34 0.88±0.43a
Male and female mixed rearing (R)
Before 85 0.34±0.19b
After 74 0.94±0.41a
P-values <0.0001
Sex (S)
Female 84 0.64±0.44
Male 75 0.59±0.42
P-values 0.4114
P-values of R × S 0.1766

a,b Values with different superscripts in column significantly differ.

Download Excel Table
3. 암수 합사 개체들의 세포 내 DNA 손상율

암수 합사 이전 및 이후 종계들의 혈액 내 백혈구를 대상으로 Comet assay를 수행하고, 세포 내 DNA 손상율을 분석한 바 이의 분석 결과를 Table 4에 제시하였다. 분석 결과, % DNA in tail, Tail moment와 Olive moment 등 모든 Comet 지표들이 암수 합사 이전에 비해 합사 이후에 유의하게 증가하는 것으로 나타났다. 반면, 암수 간 Comet 지표의 차이는 없는 것으로 나타나 합사에 따른 암수 간 반응 정도의 차이는 없는 것으로 보여진다. 일반적으로 정상적인 세포분열 조건하에서 세포 내 DNA 손실은 자연스러운 현상으로 1회 분열시 genomic DNA 130,000 base 당 최소 1 base 정도의 손상이나 변형이 발생되나, 세포가 스트레스에 노출될 경우 생성된 활성산소로 인하여 DNA의 손상이 더욱 증가한다고 알려져 있다(Richter et al., 1988; Chen et al., 2007; Sohn et al, 2012). 따라서 세포의 DNA 손상율 분석은 스트레스 반응 정도를 간접적으로 나타낼 수 있는 지표로서 single cell gel electrophoresis를 기반으로 한 Comet assay는 세포내 포괄적 DNA의 파손 정도를 분석하는 방법이다(Singh et al., 1988; Nandhakumar et al., 2011). 이의 기본 원리는 겔상의 세포에 용해제 및 고염처리 후 높은 pH 농도에서 전기영동을 하면 끊어진 DNA 사슬로 인해 핵질 내 DNA 조각들이 분리되어 양극으로 이동하게 되는데, 이러한 성질을 이용하여 형광현미경으로 관찰하면 분리된 DNA 함량에 따라 다양한 형태의 혜성(comet) 양상을 띄게 된다(Fig. 2). 이때 핵질에 해당하는 머리 대비 꼬리 부분의 명암, 면적 등이 DNA의 파손율을 반영하게 되고 이를 imaging software를 이용하여 개량화 된 Comet 지표로 분석한다(Collins, 2004). Comet assay 분석 지표로는 전체 핵 대비 DNA 파손율을 나타내는 % DNA in tail, tail내 DNA 생성율을 제시하는 Tail Moment 및 DNA 파손 분포와 정도를 상대적으로 나타내는 Olive Moment가 있다. 따라서 본 연구에서 암수 합사에 따른 모든 Comet 지표들의 상승은 세포 내 DNA 손상이 급증하였음을 의미하는 것으로 이는 닭에 있어 암수 합사가 개체들에 큰 스트레스 요인으로 작용하였음을 시사한다고 하겠다.

Table 3. Expressions of HSP genes before and after mixed rearing of male and female chickens in Korean native chicken
Rearing Sex HSP-70 HSP-90α HSP-90β
ΔCt 2-ΔΔCt ΔCt 2-ΔΔCt ΔCt 2-ΔΔCt
Before mixed rearing Female 1.08±1.10a 1.00 25.27±3.21a 1.00 4.40±1.76a 1.00
Male 0.25±1.32ab 1.78 23.59±2.74ab 3.20 3.54±1.09ab 1.82
After mixed rearing Female −1.28±1.25c 5.13 21.76±2.46b 11.39 2.44±0.88c 3.89
Male −0.41±1.34bc 2.81 23.59±2.79ab 3.20 2.95±1.37bc 2.73
Male and female mixed rearing (R)
Before 0.70±1.26a 1.00 24.49±3.09a 1.00 4.00±1.53a 1.00
After −0.81±1.36b 2.85 22.74±2.77b 3.36 2.71±1.19b 2.45
P-values 0.0038 <0.0001 <0.0001
Sex (S)
Female −0.20±1.67 1.00 23.37±3.31 1.00 3.33±1.66 1.00
Male −0.16±1.36 0.97 23.59±2.74 0.86 3.18±1.29 1.11
P-values 0.5453 0.8210 0.5511
P-values of R × S 0.0038 0.0158 0.0020

ΔCt values are equal to the difference in threshold cycles for target and internal control gene. The values of 2−ΔΔct indicate the fold change in gene expression relative to the control.

a~c Values with different superscripts in column significantly differ.

Download Excel Table
Table 4. Intra-cellular nuclear DNA damage of Korean native chickens before and after mixed rearing of male and female chickens Rearing
Rearing Sex % DNA in tail Tail moment Olive moment
Before mixed rearing Female 14.32±1.71b 18.14±1.95b 20.80±1.45b
Male 14.41±1.92b 18.43±1.84b 20.91±1.45b
After mixed rearing Female 35.39±3.34a 81.15±8.11a 82.79±7.51a
Male 36.43±2.39a 82.84±6.32a 83.10±7.84a
Male and female mixed rearing (R)
Before 14.37±1.80b 18.27±1.90b 20.85±1.44b
After 35.88±2.96a 81.95±7.32a 82.94±7.63a
P-values <0.0001 <0.0001 <0.0001
Sex (S)
Female 24.29±10.89 47.95±32.14 50.13±31.56
Male 25.42±11.29 50.63±32.74 52.00±31.79
P-values 0.1333 0.2285 0.8032
P-values of R × S 0.1939 0.3841 0.9048

a,b Values with different superscripts in column significantly differ.

Download Excel Table

사 사

본 논문은 Golden Seed Project 종축사업(과제 번호: PJ012820032020, 213010054SB230)의 지원으로 수행되었음.

REFERENCES

1.

Beloor J, Kang HK, Kim YJ, Subramani VK, Jang IS, Sohn SH, Moon YS 2010 The effect of stocking density on stress related genes and telomeric length in broiler chickens. Asian-Aust J Anim Sci 23(4):437-443.

2.

Campo JL, Gil MG, Davila SG, Munoz I 2007 Effect of lighting stress on fluctuating asymmetry, heterophil-tolymphocyte ratio, and tonic immobility duration in eleven breeds of chickens. Poult Sci 86(1):37-45.
,

3.

Chen JH, Hales CN, Ozanne SE 2007 DNA damage, cellular senescence and organismal ageing: causal or correlative? Nucleic Acids Res 35(22):7417-7428.
, ,

4.

Cho EJ, Choi ES, Sohn SH 2019 Effect of hatching and brooding season of chicks on their heat stress response and production performances. Korean J Poult Sci 46(2): 77-86.

5.

Collins AR 2004 The comet assay for DNA damage and repair: principles, applications, and limitations. Mol Biotechnol 26(3):249-261.

6.

Cotter PF 2015 An examination of the utility of heterophillymphocyte ratios in assessing stress of caged hens. Poult Sci 94(3):512-517.
, ,

7.

Cunnick JE, Kojic LD, Hughes RA 1994 Stress-induced changes in immune function are associated with increased production of an interleukin-l-like factor in young domestic fowl. Brain Behav Immun 8(2):123-136.
,

8.

Da Costa MJ, Zaragoza-Santacruz S, Frost TJ, Halley J, Pesti GM 2017 Straight-run vs. sex separate rearing for 2 broiler genetic lines part 1: live production parameters, carcass yield, and feeding behavior. Poult Sci 96(8): 2641-2661.
,

9.

Gornati R, Papis E, Simona R, Genciana T, Marco S, Giovanni B 2004 Rearing density influences the expression of stress-related genes in sea bass (Dicentrarchus labrax L.). Gene 341:111-118.
,

10.

Gous R, Moran E, Stilborn H, Bradford G, Emmans G 1999 Evaluation of the parameters needed to describe the overall growth, the chemical growth, and the growth of feathers and breast muscles of broilers. Poult Sci 78(6): 812-821.
,

11.

Gross WB 1989 Factors affecting chicken thrombocyte morphology and the relationship with heterophil:lymphocyte ratios. Br Poultry Sci 30(4):919-925.
,

12.

Gross WB, Siegel HS 1983 Evaluation of the heterophil/ lymphocyte ratio as a measure of stress in chickens. Avian Dis 27(4):972-979.
,

13.

Kamboh AA, Hang SQ, Bakhetgul M, Zhu WY 2013 Effects of genistein and hesperidin on biomarkers of heat stress in broilers under persistent summer stress. Poult Sci 92(9):2411-2418.
,

14.

Kang SY, Ko YH, Moon YS, Sohn SH, Jang IS 2013 Effect of housing systems on physiological and immunological parameters in laying hens. J Anim Sci Tech 55(2): 131-139.

15.

Lindquist S 1986 The heat-shock response. Annu Rev Biochem 55:1151-1191.
,

16.

Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25(4):402-408.
,

17.

Mashaly MM, Webb ML, Youtz SL, Roush WB, Graves HB 1984 Changes in serum corticosterone concentration of laying hens as a response to increased population density. Poult Sci 63(11):2271-2274.
,

18.

May JD, Lott BD 2001 Relating weight gain and feed:gain of male and female broilers to rearing temperature. Poult Sci 80(5):581-584.
,

19.

McFarlane JM, Curtis SE 1989 Multiple concurrent stressors in chicks. 3. Effects on plasma corticosterone and the heterophil:lymphocyte ratio. Poult Sci 68(4):522-527.
,

20.

McKee JS, Harrison PC 1995 Effects of supplemental ascorbic acid on the performance of broiler chickens exposed to multiple concurrent stressors. Poult Sci 74(11):1772-1785.
,

21.

Meng X, Jérôme V, Devin J, Baulieu EE, Catelli MG 1993 Cloning of chicken hsp90 beta: the only vertebrate hsp90 insensitive to heat shock. Biochem Biophys Res Commun 190(2):630-636.
,

22.

Mphepya LC, van Rensburg WJ, Mpofu TJ, Mtileni BJ, Nephawe KA 2019 Influence of male-male competition on reproductive performance and mortality of broiler breeders following intra-spiking. Poult Sci 98(10):4549-4554.
,

23.

Nandhakumar S, Parasuraman S, Shanmugam MM, Rao KR, Chand P, Bhat BV 2011 Evaluation of DNA damage using single-cell gel electrophoresis (Comet Assay). J Pharmacol Pharmacother 2(2):107-111.
, ,

24.

Oh SM, Yoon SY, Lee JY, Jeon SM, Oh DY, Ha JJ, Song YH, Kim JS 2019 Effect of mixed or split-sex feeding on growth performance and behavior of Korean native chicken. Ann Anim Resour Sci 30(3):105-110.

25.

Puvadolpirod S, Thaxton JP 2000 Model of physiological stress in chickens 1. Response parameters. Poult Sci 79(3): 363-369.
,

26.

Richter C, Park JW, Ames BN 1988 Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc Natl Acad Sci USA 85(17):6465-6467.
, ,

27.

Schlesinger MJ 1990 Heat shock proteins. J Biol Chem 265(21):12111-12114.

28.

Singh NP, McCoy MT, Tice RR, Schneider EL 1988 A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 175(1):184-191.

29.

Sohn SH, Jang IS, Son BR 2011 Effect of housing systems of cage and floor on the production performance and stress response in layer. Korean J Poult Sci 38(4):305-313.

30.

Sohn SH, Subramani VK, Moon YS, Jang IS 2012 Telomeric DNA quantity, DNA damage, and heat shock protein gene expression as physiological stress markers in chickens. Poult Sci 91(4):829-836.
,

31.

Soleimani AF, Zulkifli I, Omar AR, Raha AR 2011 Physiological responses of 3 chicken breeds to acute heat stress. Poult Sci 90(7):1435-1440.
,

32.

Son JH 2010 Influence of sex ratio on behavior and welfare indexes in broiler chicken. Korean J Poult Sci 37(1): 43-49.

33.

Son JH, Ravindran V, Tanaka T 2010 Effects of sex ratio on the behavioral traits of broiler chickens. Anim Behav Manage 46(2):55-60.

34.

Vleck CM, Vertalino N, Vleck D, Bucher TL 2000 Stress, corticosterone, and heterophil to lymphocyte ratios in free-living Adelie Penguins. The Condor 102(2):392-400.

35.

Zulkifli I, Al-Aqil A, Omar AR, Sazili AQ, Rajion MA 2009 Crating and heat stress influence blood parameters and heat shock protein 70 expression in broiler chickens showing short or long tonic immobility reactions. Poult Sci 88(3):471-476.
,

36.

Zulkifli I, Che Norma MT, Chong CH, Loh TC 2000 Heterophil to lymphocyte ratio and tonic immobility reactions to preslaughter handling in broiler chickens treated with ascorbic acid. Poult Sci 79(3):402-406.
,

37.

Zulkifli I, Norma MTC, Israf DA, Omar AR 2002 The effect of early-age food restriction on heat shock protein 70 response in heat-stressed female broiler chickens. Poult Sci 43(1):141-145.
,

[공지] 한국가금학회 학술지 영문화 전환 및 논문 투고 안내


안녕하십니까, 한국가금학회 편집위원회입니다.

저희 한국가금학회는 학술지의 국제적 위상 제고와 연구 성과의 폭넓은 공유를 위해,
2025년 11월 정기총회에서 영문 학술지로의 전환을 결정한 바 있습니다.

앞으로 본 학술지는 모든 투고 논문을 영문으로 작성하여 접수받으며,
국제적인 심사 기준을 통해 고품질의 연구를 게재하고자 합니다.

새로운 도약을 위한 이번 변화에 회원 및 연구자 여러분의 적극적인 관심과 투고를 부탁드립니다.

 

1. 주요 변경 사항
 · 투고 언어: 전면 영문
 · 적용 시기: 2026년 5월 투고분부터

 

2. 학술지명 변경
 · 기존: 한국가금학회지, Korean Journal of Poultry Science
 · 변경: Poultry Science and Biotechnology

 

3. 논문 투고 및 심사 안내
 · 투고처: https://www.ekjps.org (온라인 논문 투고 시스템 링크 )
 · 투고 규정: 새로운 영문 템플릿 준수
 · 문의: 편집위원장

 

더욱 발전된 모습으로 학문 교류의 장이 될 수 있도록 최선을 다하겠습니다.

 

감사합니다.

 

(사)한국가금학회 회장 민원기 올림

(사)한국가금학회 편집위원장 허정민 올림


I don't want to open this window for a day.