Article

육계 사료 내 삼채뿌리분말 첨가가 장내 미생물 및 장관면역에 미치는 영향

지운학1,*https://orcid.org/0009-0000-5154-8867, 조인호2,*https://orcid.org/0000-0003-2367-5468, 주상석1https://orcid.org/0000-0001-8909-1102, 정문경1https://orcid.org/0009-0003-9194-2887, 이채원2https://orcid.org/0000-0002-8281-5478, 윤준혁2https://orcid.org/0000-0002-1862-1281, 안수현3,4https://orcid.org/0000-0001-6236-6815, 김명후5,6,https://orcid.org/0000-0002-8444-6952, 공창수7,8,9,https://orcid.org/0000-0002-3876-6488
Woonhak Ji1,*https://orcid.org/0009-0000-5154-8867, Inho Cho2,*https://orcid.org/0000-0003-2367-5468, Sang Seok Joo1https://orcid.org/0000-0001-8909-1102, Moongyeong Jung1https://orcid.org/0009-0003-9194-2887, Chae Won Lee2https://orcid.org/0000-0002-8281-5478, June Hyeok Yoon2https://orcid.org/0000-0002-1862-1281, Su Hyun An3,4https://orcid.org/0000-0001-6236-6815, Myunghoo Kim5,6,https://orcid.org/0000-0002-8444-6952, Changsu Kong7,8,9,https://orcid.org/0000-0002-3876-6488
Author Information & Copyright
1부산대학교 동물생명자원과학과 대학원생
2경북대학교 축산BT학과 대학원생
3경북대학교 축산BT학과 박사후연구원
4경북대학교 말산업연구원 박사후연구원
5부산대학교 동물생명자원과학과 교수
6부산대학교 생명산업융합연구원 교수
7경북대학교 축산학과 교수
8경북대학교 축산BT학과 교수
9경북대학교 말산업연구원 교수
1Graduate Student, Department of Animal Science, College of Natural Resources and Life Sciences, Pusan National University, Miryang 50463, Republic of Korea
2Graduate Student, Department of Animal Science and Biotechnology, Kyungpook National University, Sangju 37224, Republic of Korea
3Post-Doctoral Researcher, Department of Animal Science and Biotechnology, Kyungpook National University, Sangju 37224, Republic of Korea
4Post-Doctoral Researcher, Research Institute of Horse Industry, Kyungpook National University, Sangju 37224, Republic of Korea
5Professor, Department of Animal Science, College of Natural Resources and Life Sciences, Pusan National University, Miryang 50463, Republic of Korea
6Professor, Life and Industry Convergence Research Institute, Pusan National University, Miryang 50463, Republic of Korea
7Professor, Department of Animal Science, Kyungpook National University, Sangju 37224, Republic of Korea
8Professor, Department of Animal Science and Biotechnology, Kyungpook National University, Sangju 37224, Republic of Korea
9Professor, Research Institute of Horse Industry, Kyungpook National University, Sangju 37224, Republic of Korea

* These authors have contributed equally to this work.

To whom correspondence should be addressed : mhkim18@pusan.ac.kr, changsukong@knu.ac.kr

© Copyright 2023, Korean Society of Poultry Science. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Aug 20, 2023; Revised: Sep 12, 2023; Accepted: Sep 12, 2023

Published Online: Sep 30, 2023

적요

본 연구는 부화 후 10일부터 28일까지 사료내 삼채뿌리분말 첨가가 장내 미생물 균총, 장관면역, 및 장건강에 미치는 영향을 평가하고자 수행하였다. 10일령 Ross 308 육계 총 60수를 공시하여 체중을 측정한 후 난괴법을 이용하여 6반복으로 2처리구에 할당하였다. 실험사료는 옥수수-대두박 기반의 대조사료와 대조사료에서 옥수수 0.3% 대신 삼채뿌리분말 0.3%를 첨가한 처리사료로 구성하였고, 18일간 사료와 물을 무제한 급이하였다. 부화 후 28일째에 각 케이지마다 체중 중앙값에 근접한 2수를 선발하여 맹장내 분변 및 장관조직 샘플을 수집하였다. 사료내 삼채뿌리분말 첨가가 Enterococcaceae, Lactobacillaceae,Limosilactobacillus, CuneatibacterRuminococcoides와 같은 생균제 후보 미생물을 증가시킴을 확인하였다. 장관면역의 경우, 삼채뿌리분말 첨가가 helper T cell의 한 종류인 CD3+CD4+ T cell의 유의미한 감소(P=0.049)를 야기하였다. 또한 삼채뿌리분말 첨가가 사이토카인 및 항산화기능 관련 유전자 발현 분석에서 IL1b, IL6, 및 IL10과 같은 사이토카인에는 유의미한 차이가 관찰되지 않았으나 항산화기능 관련 유전자 GPX2 발현이 증가하는 경향이 확인되었다 (P=0.060). 따라서 본 연구의 결과를 종합해보면, 삼채뿌리분말을 첨가한 육계사료를 부화 후 10일부터 28일까지 급이 시 육계 장내미생물에 긍정적인 영향을 주고, 장건강을 향상시킬 수 있을 것으로 사료된다.

Abstract

This study was conducted to investigate the effects of supplementation of Allium hookeri (AH) root powder on the gut microbiome, immunity, and health in broiler chickens fed experimental diets from d 10 to 28. A total of 60 10-day-old Ross 308 broilers were weighed and assigned to two dietary treatments with 5 birds per cage in a randomized complete block design based on body weight. The two experimental diets consisted of a control diet based on corn-soybean meal and the control diet supplemented with 0.3% AH root powder. All birds were fed ad libitum with experimental diets and water for 18 d. At 28 d, two birds near the median weight from each cage were selected for cecal content and small intestinal tissue sample collection. The addition of AH changed the gut microbiome by increasing probiotic candidate beneficial bacteria such as Enterococcaceae, Lactobacillaceae, Limosilactobacillus, Cuneatibacter, and Ruminoccoides. Regarding gut immunity, the supplementation of AH resulted in changes in intestinal immune cells, including reduced CD3+CD4+ T cells, which are a type of helper T cell, in the small intestine of birds (P=0.049). Additionally, there was a tendency to increase the expression of antioxidant function-related gene such as GPX2 (P=0.060), but no significant changes were observed in cytokines such as IL1b, IL6, and IL10. Overall, the addition of AH root powder may have positive effects on the microbiome of the chickens. This may help promote gut health in broiler chickens at the age of d 10 to 28.

Keywords: 삼채뿌리; 육계; 사료 첨가제; 장관면역; 장내 미생물
Keywords: Allium hookeri; broiler; feed additive; gut immunity; gut microbiome

서 론

소화장관은 경제동물의 생산성 및 건강 상태에 직접적인 영향을 미치는 중요한 기관이다(Lan et al., 2005). 소화장관은 음식물의 소화를 담당할 뿐 아니라 동물의 면역체계로도 매우 중요한 역할을 하는 기관으로 알려져 있다. 특히 소화장관의 면역은 장관내에 공생하는 미생물이나 음식물이 분해되어 생산되는 다양한 대사산물 등과 상호작용하여 동물의 건강에 큰 영향을 미친다고 알려져 있다(Choct, 2009; Chase, 2018). 다른 동물들과 마찬가지로 육계의 장관에도 다양한 장관관련림프조직(gut-associated lymphoid tissue)이 존재하는데 그중 점막 고유층(lamina propria, LP)에는 T cell이나 항원제시세포(antigen presenting cell, APC)와 같은 다양한 면역세포들이 존재하며 이는 선천성 면역과 적응성 면역을 조절하여 장관면역 항상성을 유지시킨다(El-Sharkawy et al., 2020; Song et al., 2021). 경제동물의 장관면역은 출생 전부터 서서히 발달하기 시작하여(Wynn and Levy, 2010), 출생 후 지속적인 외부 환경 자극에 의해 발달이 완성된다고 알려져 있다(Gordon and Manley, 2011). 특히, 장관면역의 발달에 영향을 미치는 요인으로는 동물이 섭취하는 영양분이나 다양한 환경적 자극 요인이 포함되는데, 최근 대표적인 장관면역 발달 촉진인자 중 하나로 장내 미생물이 주목을 받고 있다(Kober et al., 2022). 영양학적 관점에서 장내 미생물은 숙주가 소화시키지 못하는 물질을 분해하고 유용한 대사산물을 생산하여 추가적인 에너지를 공급하는 역할을 담당한다(Rehman et al., 2007). 또한 면역학적인 관점에서 장내 미생물은 면역세포 활성을 조절하거나, 다른 병원균의 증식을 억제하고 장관점막이나 LP의 발달을 촉진하는 등 장관면역에 중요한 영향을 미친다고 보고되고 있다(Jandhyala et al., 2015). 육계에서 장내 미생물의 정착은 부화 직후부터 약 21일까지 점진적으로 진행되는 것으로 알려져 있다(Crhanova et al., 2011). 이러한 초기 육계 장내 미생물의 정착은 장관면역의 발달을 촉진하는 중요 요인이다(Rubio, 2019). 이를 바탕으로 장관면역과 장내미생물의 상관관계에 대한 연구가 활발히 이루어지고 있으나 경제동물 분야에서는 아직 연구가 미흡한 상태이다(Chung et al., 2012; Rooks and Garrett, 2016). 특히 육계 성장에 따른 장내 미생물의 역할과 미생물에 의한 면역세포 변화에 대한 연구는 매우 부족한 실정이다.

최근 전세계적으로 육류 소비가 증가하고, 그 중 육계를 포함한 가금류는 소비량이 가장 많은 가축 중 하나이다(Wessels et al., 2021). 가금류의 안정적인 생산을 위해 가금류에 대한 항생제 및 성장 촉진제의 사용은 다른 가축보다 상대적으로 높은 것으로 알려져 있다(Van Boeckel et al., 2015). 최근 가축 대상의 항생제나 성장 촉진제 사용 규제 뿐 아니라 항생제의 사용이 동물의 면역력을 감소시킬 수 있다는 문제점이 제시되면서 안전한 항생제 대체제 개발 요구가 증가하고 있다(Khan et al., 2022). 항생제 대체제 후보 중 하나로 다양한 천연물질을 이용하여 장내 미생물 환경을 개선하거나 장관면역 발달을 촉진시키려는 노력들이 시도되고 있으며(An et al., 2020; Kwak et al., 2022; Rim et al., 2022), 가축의 사양성적 향상과 더불어 항균, 항염증, 항산화효과 및 면역력 증진 등 다양한 주제로 연구가 진행되고 있다(Sharifi-Rad et al., 2016; Sugiharto, 2016; Kothari et al., 2019).

삼채(Allium hookeri)는 인도, 미얀마, 스리랑카 등을 원산지로 하는 부추속의 식물이다(Kothari et al., 2019). 삼채는 기존 원산지 외 아시아에서도 널리 재배되어 한국에서 잘 알려진 식품이며, 사포닌과 유기황 화합물이 풍부하며 항염증, 항균효과는 물론 제2형 당뇨병과 심혈관 질환에도 효과가 있다고 알려져 건강식품 및 약용식품으로 널리 사용되고 있다(Kothari et al., 2019; Deka et al., 2021). 경제동물분야에서 삼채는 육계의 성장에 도움을 줄 뿐 아니라 in vitro 연구에서 삼채 뿌리 및 잎 추출물이 면역조절 효과가 있음이 보고된 바 있다(Lee et al., 2017; Kothari et al., 2019). 또한 삼채가 속하는 Allium속의 식물을 첨가한 사료가 육계의 장내 미생물 조성의 변화를 유도한다는 것이 보고된 바 있다(Lee et al., 2019; Lee et al., 2020).

앞선 선행연구들에 의하면 삼채 유래 물질이 육계의 성장이나 면역을 조절할 가능성들이 일부 제시된 바 있으나(Lee et al., 2018; Kothari et al., 2019), 삼채 뿌리 첨가가 육계의 장내 미생물과 장관면역에 미치는 영향에 대해서는 자세히 연구되지 않았다. 따라서 본 연구는 육계 사료 내 삼채뿌리분말의 첨가가 장내 미생물의 발달, 장관면역, 및 장건강에 미치는 영향을 평가하기 위해 수행되었다.

재료 및 방법

본 연구의 동물실험은 경북대학교 동물실험윤리위원회 규정에 따라 진행되었다(승인번호: KNU2022-0202).

1. 동물실험
1) 실험동물 및 실험설계

초생추인 육계(Ross 308) 수평아리 60수를 공시하여 개별 인식표를 부착하고 10일간 시판 초이사료(대사에너지 3,000 kcal/kg; 조단백질 21%)를 급이하였으며 10일차에 개별체중을 측정한 후 난괴법을 이용하여 처리구의 평균체중(235±25.6 g)이 유사하도록 2개의 처리구에 케이지(50 × 60 × 60 cm)당 5수씩 총 6반복으로 배치하였다(Kim and Lindemann, 2007). 구배치 후 실험사료를 급이하였고 온도와 습도가 조절되는 공간의 배터리 케이지에서 부화 후 10~28일까지 전기(10~21일) 및 후기(21~28일)기간 동안에 걸쳐 실험을 수행하였다.

2) 사양관리 및 실험사료

전체 실험기간 동안 사료와 물은 자유롭게 섭취하도록 하였고 24시간 종일 점등하였으며 계사내 습도는 40~50%가 되도록 유지하였다. 계사내 온도는 부화 후 34°C로 유지하였고 이후 단계적으로 낮추어 부화 후 28일에 25°C가 되도록 조절해주었다.

실험에 사용한 사료는 옥수수-대두박 위주의 대조사료와 대조사료 내 옥수수 중 0.3%를 삼채뿌리분말로 대체한 처리사료로 2가지 사료로 구성하였고(Table 1) 사료내 영양소 및 아미노산 함량 계산치에 대한 정보는 Table 2와 같았다. 사료내 아미노산 함량과 비타민 및 광물질 함량은 각각 Aviagen(2019)에서 제시하는 성장단계별 기준치에 맞춰 배합하였다.

Table 1. Ingredient and nutrient composition of experimental diets (as-fed basis)
Item Grower Finisher
Control Allium hookeri Control Allium hookeri
Ingredient (%)
Corn 53.25 53.25 57.27 57.27
Soybean meal 37.58 37.58 34.09 34.09
Corn(trituration) 1.00 0.70 1.00 0.70
Allium hookeri 0.00 0.30 0.00 0.30
Soybean oil 3.00 3.00 3.00 3.00
L-Ile 0.05 0.05 - -
L-Lys-HCl 0.15 0.15 0.05 0.05
L-Met 0.21 0.21 0.18 0.18
L-Cys 0.14 0.14 0.09 0.09
L-Thr 0.12 0.12 0.06 0.06
L-Val 0.08 0.08 0.03 0.03
Limestone 1.22 1.22 1.14 1.14
Monocalcium phosphate 1.60 1.60 1.49 1.49
Salt 0.40 0.40 0.40 0.40
Vitamin premix1 0.50 0.50 0.50 0.50
Mineral premix2 0.50 0.50 0.50 0.50
Choline chloride 0.20 0.20 0.20 0.20
Total 100.00 100.00 100.00 100.00

1 Supplies the following quantities per kilogram of diet: vitamin A, 31,500 IU; vitamin D3, 12,500 IU; vitamin E, 175 mg; vitamin K3, 8.75 mg; vitamin B1, 10 mg; vitamin B2, 30 mg; vitamin B6, 15 mg; folic acid, 7.5 mg; calpan, 75 mg; niacin, 12 mg; biotin, 0.5 mg; proviox50, 10 mg.

2 Supplies the following quantities per kilogram of diet: Fe, 250 mg; Cu, 85 mg; Zn, 460 mg; Mn, 5,000 mg; Co, 0.75 mg; Se, 1.5 mg; I, 7.5 mg/kg.

Download Excel Table
Table 2. Calculated energy and nutrient compositions of the experimental diets (as-fed basis)
Item Grower Finisher
Control Allium hookeri Control Allium hookeri
Calculated value
MEn1 (kcal/kg) 2,900 2,889 2,948 2,938
Crude protein (%) 21.5 21.5 20.0 20.0
Ca (%) 0.87 0.87 0.81 0.81
Non-phytate P (%) 0.43 0.43 0.40 0.40
SID2 amino acids (%)
Arg 1.24 1.24 1.25 1.25
His 0.47 0.47 0.47 0.47
Ile 0.77 0.77 0.75 0.75
Leu 1.49 1.49 1.52 1.51
Lys 1.15 1.15 1.06 1.06
Met 0.46 0.46 0.44 0.44
Cys 0.37 0.37 0.35 0.35
Phe 0.90 0.90 0.89 0.89
Thr 0.77 0.77 0.74 0.74
Trp 0.24 0.24 0.20 0.20
Val 0.89 0.88 0.85 0.85

1 MEn, nitrogen corrected metabolizable energy.

2 SID, standardized ileal digestible.

Download Excel Table
3) 샘플 수집

실험종료시 대조사료 및 삼채 처리사료구의 최종체중은 각각 1,100 및 1,149 g이었으며, 맹장내 분변 및 장관조직 샘플은 각 케이지내 중앙 체중에 가까운 2수를 선발하여 CO2로 안락사 시킨 후, 수집하였다. 수집된 맹장내 분변은 장내 미생물 군집 분석을 위해 초저온 냉동고(−80°C)에 보관하였다. 장관조직은 메켈게실을 기준으로 하여 공장을 수집한 후 10% 포르말린(4% formaldehyde)에 넣어 고정시킨 후 4°C에 냉장보관 하였다.

2. 조사항목 및 방법
1) 장내 미생물 군집 분석

미생물 군집 분석을 위해 맹장내 분변의 미생물 DNA는 DNeasy PowerSoil Kit(Cat. No. 12855, Qiagen, Hilden, Germany)를 사용하여 제조사의 프로토콜에 따라 추출하였다. Illumina 16S Metagenomics Sequencing Library 프로토콜에 의해, sequencing library는 V3 및 V4 영역 사이에서 증폭하기 위해 준비하였다. 추출된 미생물 DNA는 일반 프라이머와 Herculase II 융합 DNA 중합효소(Agilent Technologies, Santa Clara, CA, USA)로 PCR 증폭되었다. 1차 증폭에 사용된 Illumina adapter overhang 서열을 갖는 일반 프라이머 쌍은 다음과 같다: V3-F:5’-TCGTCGGCAGCGT CAGATGTGT ATAAGAGACAGCCTACGGGNGGCWGCAG-3’, V4-R: 5’-GT-CTCGTGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’. PCR은 다음 순서에 따라 진행되었다: (1) 95°C에서 3분, (2) 95°C에서 30초, 55°C에서 30초, 72°C에서 30초를 25 사이클 반복, (3) 72°C에서 5분. PCR 결과물은 순도를 확인하기 위해 AMPure beads(Beckman Coulter, Brea, CA, USA)를 사용하여 확인되었으며, 최종 정제된 제품의 양을 확인하기 위해 qPCR 정량화 프로토콜 가이드(KAPA Library Quantification kits for Illumina sequencing platforms)에 따라 정량화하고 TapeStation D1000 ScreenTape (Agilent Technologies, Waldbronn, Germany)를 사용하여 검증했다. 그 후, paired-end(2 × 300 bp) sequencing은 MiSeq platform (Illumina, San Diego, CA, USA)을 사용하여 Macrogen에서 실시하였다. Index sequences를 통해 데이터를 분류한 다음, 각 FASTQ 데이터를 생성하고 Cutadapt(v3.2)를 사용하여 어댑터와 프라이머 시퀀스를 대상 유전자영역에서 제거했다(Martin, 2011). 시퀀스오류를 조정하기 위해 DADA2(v1.22.0)를 사용하였다. Paired-end read를 대상으로 Forward 서열(Read1)과 Reverse 서열(Read2)을 250 bp 또는 200 bp로 자르고, 예상오류가 2 이상인 시퀀스는 제외하여 amplicon sequence variant(ASV)을 생성하였다. 미생물 조성을 분석하기 위해 QIIME(v1.9)프로그램을 사용하여 전체 시료 중 최소 판독 횟수를 가진 시료의 판독 횟수를 기준으로 subsampling 및 정규화를 진행하였다. 각 ASVs 서열은 Reference DB (NCBI 16S Microbial DB)에 BLAST+(v2.9.0)를 실시하여 유사 미생물 검출을 위한 분류 정보를 할당하였다. 미생물 군집 데이터를 비교, 분석하기 위해 QIIME2를 사용하여 ASV의 풍부도 및 분류 정보를 사용하였다. 샘플내 미생물 군집의 다양성과 균일성을 확인하기 위해 Shannon 지수와 Simpson 지수, Chao1 지수를 통해 알파 다양성을 확인하였다. 육계 사료내 삼채뿌리분말의 첨가가 장내 미생물의 조성변화에 미치는 영향을 확인하기 위해 Huttenhower Lab Galaxy Server 2.0에서 Linear discriminant analysis Effect size(LEfSe) (http://galaxy.biobakery.org/)를 실행하여 linear discriminant analysis(LDA) score를 확인하였다.

2) 장관면역 분석
(1) 소장 고유층 분리

육계 소장 고유층 분리는 기존 방식에서 수정된 방법에 따라 실시하였다(Joo et al., 2022). 공장 조직을 RPMI 1640(Gendepot, Barker, TX, USA) 배지에 10% fetal bovine serum(Gibco BRL, Burlington, ON, Canada), 1% penicillin-streptomycin(HyClone, Logan, UT, USA)을 혼합하여 만든 배지(cRPMI)에 옮긴 다음, 장간막과 지방을 제거하였다. 장간막과 지방이 제거된 공장의 긴 축을 따라 가위로 잘라 장을 펴고 차가운 인산완충생리식염수(phosphate buffered saline, PBS; Thermo Fisher Scientific, Waltham, MA, USA)에서 점막과 장내 내용물을 제거하였다. 내용물을 제거한 공장 조직을 1~2 cm 길이로 잘라 차가운 PBS에서 2분간 세척하고, 세포분리용액(1 mM DL-Dithiothreitol(DTT; Sigma-Aldrich, St. Louis, MO, USA), 10 mM 4-[2-hydrxyethyl]-1-piperazineethanesulfonic acid(HEPES; Thermo Fisher Scientific, Waltham, MA, USA), 30 mM ethylenediamine-tetraacetic acid (EDTA; Thermo Fisher Scientific, Waltham, MA, USA)이 포함된 PBS에 넣어 진탕배양기를(200RPM, 37°C) 10분간 작동하였다. 이후 세포분리용액이 첨가된 PBS를 사용하여 조직을 1분간 세척하고 30 mM EDTA 및 10 mM HEPES를 포함하는 PBS에서 진탕배양기를(200 RPM, 37°C) 10분간 다시 작동하였다. 조직을 PBS에서 1분간 세척하고, cRPMI에서 조직이 상하지 않도록 약하게 2분간 세척하였다. 마지막으로 조직을 0.5 mg/mL collagenase type VIII(Sigma-Aldrich, St. Louis, MO, USA)가 함유된 cRPMI 배지에서 진탕배양기를(200 RPM, 37°C) 60분간 작동하고 PBS에 1분간 세척하였다. 원심분리기(800 g, RT, 5분; High-speed Centrifuges 1580R, Gyrozen Co., LTD, Seoul, Korea of Republic)를 사용하여 상층액을 분리하여 제거한 다음, 세포상층액을 Percoll(GE Healthcare, Chicago, Illinois, US)의 농도차이(상단에 40% Percoll, 하단에 70% Percoll)를 사용하여 분리하여 유세포 분석에 사용하였다.

(2) 유세포 분석

분리된 소장 고유층 세포는 FACS Canto II(Becton, Dickinson and Company, Franklin Lakes, NJ, USA)를 사용하여 분석하였다. 살아있는 세포와 죽은 세포를 구별하기 위해 Live/Dead Fixable Dead Cell Stain(Thermo Fisher Scientific, Waltham, MA, USA)을 PBS에 1:1,000의 비율로 희석하여 사용하여 죽은 세포를 제외하였다. 분석을 위해 사용한 항체는 다음과 같다. T-cell 분석: anti-CD3(CT-3; SouthernBiotech, Birmingham, AL, USA), anti-CD4(CT-4; SouthernBiotech, Birmingham, AL, USA), anti-CD8a(CT-8; SouthernBiotech, Birmingham, AL, USA) 그리고 anti-TCRγδ(TCR-1; SouthernBiotech, Birmingham, AL, USA), APC 분석: anti-MHC II(2G11; SouthernBiotech, Birmingham, AL, USA), anti-Bu-1(AV20; SouthernBiotech, Birmingham, AL, USA) 그리고 anti-Monocyte/Macrophage(KUL01; SouthernBiotech, Birmingham, AL, USA). 모든 항체는 PBS에 1:200로 희석하여 30분 동안 어두운 환경에서 반응하도록 한 다음 염색된 세포를 원심분리기(800 g, 4°C; High-speed Centrifuges 1580R, Gyrozen Co., LTD, Seoul, Korea of Republic)로 5분간 작동하여 상층액을 제거하였다. 그리고 세포에 PBS를 넣어 마르지 않도록 하여 분석할 때까지 4°C 환경에서 보관하였다.

3) 사이토카인 및 항산화기능 관련 유전자 발현

TRIzol™ Reagent(Thermo Fisher Scientific, Waltham, MA, USA)에 보관한 공장 조직에서 RNA를 추출하였다. 공장 조직을 클로로포름(Sigma-Aldrich, St. Louis, MO, USA)으로 추출하고 이소프로판올(Biosang, Seoul, Republic of Korea)을 사용하여 RNA를 침전시킨 후 75% 알코올(Biosang, Seoul, Republic of Korea)로 세척하여 순수한 RNA를 획득했다. 그 다음 Nano-400A(Hangzhou Allsheng Instruments Co., LTD, Hangzhou, China)을 이용하여 농도와 순도를 확인한 다음 회사지침에 따라 AccuPower ® RT PreMix(Bioneer, Daejeon, Republic of Korea)를 사용하여 분리된 RNA로 cDNA를 합성하였다. 사이토카인 및 항산화기능 관련 유전자의 발현정도를 확인하기 위해 QuantStudio 1 Real Time PCR 시스템(Applied Biosystems, Waltham, MA, USA)을 사용하여 qRT-PCR을 실시하였다. 해당 실험에서 사용한 프라이머에 대한 정보는 Table 3과 같았다. qRT-PCR은 다음의 순서로 진행되었다: 94°C에서 5분, 94°C에서 20초, 60°C에서 20초, 72°C에서 20초를 40 cycle 진행 이후 5분간 65~95°C Melting curve 분석을 실시하였다. 상대 정량은 2−ΔΔCT 방법을 이용하여 계산하였고 하우스키핑 유전자로는 Glyceraldehyde-3-phosphate dehydrogenase를 사용하였다.

Table 3. List of chicken primers used in the study
Genes Forword Reverse Size (bp) Annealing TM (°C)
IL1b GCTCTACATGTCGTGTGTGATGAG TGTCGATGTCCCGCATGA 80 60
IL6 CTCCTCGCCAATCTGAAGTC GGATTGTGCCCGAACTAAAA 164 60
IL10 CATGCTGCTGGGCCTGAA CGTCTCCTTGATCTGCTTGATG 94 60
SOD1 AGGGGGTCATCCACTTCC CCCATTTGTGTTGTCTCCAA 122 60
CAT TTACGGAGGTAGAACAGATGG TGTCAGGATACGCAAAGAGA 105 60
GPX2 ACGGCACCAACCAGGAGAT TTCAGGTAGGCGAAGACGG 133 60
Download Excel Table
3. 통계분석

육계 사료내 삼채뿌리분말의 첨가가 장내 미생물의 조성에 끼치는 영향과 장내 면역세포 및 사이토카인과 항산화기능 관련 유전자의 발현에 대한 결과의 통계분석은 Prism(GraphPad Software, Boston, MA, USA) 프로그램을 이용하여 실시하였다. 대조군과 처리군간 장내 미생물 조성의 차이는 LEfSe 분석으로 나타냈으며, 두 그룹 사이의 미생물 군집의 유의한 차이를 식별하기 위해 Kruskal-Wallis sum-rank 검정을 실시하여 LDA score가 2.0 이상인 것을 유의적인 차이를 나타낸다고 판단하였다. 장내 미생물 다양성 분포와 장내 면역세포 및 사이토카인과 항산화기능 관련 유전자의 발현에 대한 변화는 two-tailed unpaired t-test를 이용하여 분석하였다. 통계분석 시 실험단위는 케이지이며 모든 통계분석에서 유의성은 0.05<P<0.1일 경우 경향성이 있다고 판단하고, P<0.05일 경우 유의하다고 판단하였다. 모든 실험 데이터는 평균 ± 표준 편차로 표시되었다.

결과 및 고찰

1. 장내 미생물 군집 분석

장내 미생물은 경제동물의 면역과 영양대사에 중요한 역할을 담당한다고 알려져 있으며, 또한 소화장관에 침입하는 병원균을 직접적으로 제한하는 선천성 면역의 일부를 담당하기도 한다(Kober et al., 2022). 따라서 장내 미생물 군집 균형이 무너지게 되면 숙주동물의 병원균에 대한 저항성이 낮아져 숙주의 장건강에 부정적인 영향을 미치고 결과적으로 동물의 성장에 영향을 주어 생산성을 떨어뜨리게 된다(O’Hara et al., 2020; Sun et al., 2020). 경제동물 사료내 첨가제는 장내 미생물 군집을 안정화시키고 숙주의 면역력 향상에 도움을 주는 등의 효과가 있다고 알려져 있다. 따라서 사료내 첨가제는 경제동물의 생산성 향상과 사료 효율성 증진에 긍정적인 효과를 기대할 수 있다(Sugiharto, 2016). 육계의 성장과 영양대사 및 면역에 영향을 미치는 장내 미생물이 존재하는데 이는 육계의 성장에 큰 영향을 미치는 요인이라 할 수 있다(Rubio, 2019). 따라서 질병이나 환경에 대한 저항성이 성체에 비해 떨어지는 미성숙한 육계의 경우 장내 미생물 군집의 안정적 정착은 매우 중요하다. 육계의 장내에 존재하는 우세한 미생물은 속수준에서 Lactobacillus, Ruminococcus이 있으며, 과수준에서는 Bacteroidaceae, Ruminococcaceae, Clostridiaceae, Lachnospiraceae, Enterococcaceae 및 Enterobacteriaceae가 알려져 있다(Wei et al., 2013; Rubio, 2019). 해당 미생물들은 숙주가 소화하지 못하는 탄수화물을 분해하고 숙주 건강과 생산성을 향상시킬 수 있는 단쇄지방산(Short chain fatty acids, SCFAs)을 생산한다고 알려져 있다(Morrison and Preston, 2016). 또한 경쟁을 통해 병원성 미생물의 성장을 저해하고 장 상피층 및 점액층의 발달을 촉진하는 역할을 한다(Wei et al., 2013). 특히 Lactobacillus는 육계뿐만 아니라 사람을 포함한 여러 경제동물의 장관면역 향상을 위한 생균제로 활용되는 미생물로 알려져 있다(Zhang et al., 2021; Kober et al., 2022).

육계의 장내 미생물 균총은 소장, 회장, 맹장 등 소화장관의 위치별로 서로 다른 비율과 다양성을 가지는 것으로 알려져 있다. 맹장은 소화기관 중 가장 오랜 시간동안 음식물이 머무는 곳임과 동시에 미생물로 인한 발효 및 물질흡수가 일어나는 장소이며 많은 장내 미생물이 존재한다(Gong et al., 2002). 육계의 장내 미생물 군집 풍부도 및 다양성은 육계의 장관면역 활성에 영향을 주는 것으로 알려져 있다(Rubio, 2019). 본 실험에서는 사료내 삼채뿌리분말 첨가로 인한 육계의 장내 미생물의 풍부도 및 다양성 변화를 조사하기 위해 Chao1, Shannon 및 Simpson index 분석을 실시하였다(Fig. 1). 육계사료내 삼채뿌리분말 첨가는 장내 미생물 군집의 종 풍부도 및 다양성에서 유의미한 차이를 보여주지 않았다(Fig. 1). 이와 유사하게 육계에 삼채 잎과 뿌리분말을 일정 비율로 첨가한 사료를 급여하였을 때 Shannon 지수에는 큰 차이가 없다는 결과가 보고된 바 있다(Lee et al., 2020).

kjps-50-3-171-g1
Fig. 1. Effect of supplementation of AH in diet on alpha diversity. Alpha diversity measured by the diversity index was indicated by control (red) and AH (blue). The line in each box means the center value, and whiskers showed the highest and lowest values within the 1.5th quartile range (IQR). Significant differences between treatments were analyzed using the two-tailed unpaired t-test. AH, Allium hookeri.
Download Original Figure

삼채에는 알라닌, 사포닌과 같은 물질이 존재하며 해당 물질은 삼채를 포함한 Allium에 속하는 식물이 함유하고 있다. 삼채와 비슷한 물질을 가진 양파를 사용한 가금 실험 결과 Bacteroidetes가 증가하거나 Escherichia coliStaphylococcus aureus같은 특정 장내 미생물군을 감소시키는 등 장내 미생물 균총의 변화가 발생함이 보고된 바 있다(Kothari et al., 2019). 그러므로 삼채뿌리분말 첨가가 특정 미생물 균총의 증감을 유도했을 가능성에 대해 분석을 실시하였다(Fig. 2). 장내 미생물 균총 분포 분석 결과, 대조군과 처리군 모두 Phylum 수준에서 Firmicutes, Bacteroidetes, Proteobacteria, Actinobacteria 순서로 나타났으며 이는 선행연구 결과와 거의 일치하는 수준이었다(Rychlik, 2020). 대조군과 처리군의 비교 결과, 수치적으로 대조군에 비해 처리군에서 Firmicutes의 비율이 5% 높았고, Bacteroidetes의 비율은 대조군에 비해 4% 낮았다(Fig. 2A). ProteobacteriaSalmonellaCampylobacter같은 육계에게 치명적인 감염성 장질환을 일으키는 병원균을 포함하는 Phylum이다(Heres et al., 2004; Yang et al., 2021). Proteobacteria는 부화 후 초기 육계에서 다른 장내 미생물보다 빠르게 군집화가 일어나 초기 육계성장에 악영향을 주지만, 이후 FirmicutesBacteroidetes의 증가로 인해 개체수가 감소하여 활성이 떨어진다고 알려져 있다(Segura-Wang et al., 2021). 본 연구에서 Proteobacteria은 큰 변화가 없이 대조군과 처리군에서 비슷한 수준을 보였다. 다음으로 Family 수준에서 Oscillospiraceae가 대조군(31.5%)에 비해 처리군(18.6%)에서 낮았고, Enterococcaceae 및 Lactobacillaceae은 각각 대조군(3.84%, 1.48%)에 비해 처리군(8.36%, 4.07%)에서 높았다(Fig. 2B). Oscillospiraceae는 육계의 맹장내 미생물 군집의 대부분을 차지하는 Firmicutes에 속하며, 일부 다른 장내 미생물과 상호작용하여 SCFAs를 합성하는 데 도움을 주고 분변을 부드럽게 하여 배변을 용이하게 하는 균으로 알려져 있으나, 특정 조건에서는 대장염과 같은 염증성 질환을 일으키는 병원균으로써 작용하기도 하므로 Oscillospiraceae에 대한 명확한 기능과 역할에 대해서는 추가적인 연구가 필요하다(Mu et al., 2023). Enterococcaceae 및 Lactobacillaceae는 Lactobacillales에 속하는 젖산 생성균이다(Rossi et al., 2016). 젖산은 미생물의 세포막 파괴, DNA변형 및 세포사멸의 역할을 하며 장내 미생물 군집변화에 영향을 주는데, 이때 장내 병원균 사멸을 통해 장관면역 향상 및 생산성을 증가시킬 수 있다고 알려져 있다(Pessione, 2012). Enterococcaceae 및 Lactobacillaceae는 육계의 괴사성 장염을 치료하는 잠재적인 생균 균주임을 밝힌 연구결과가 있다(Fasina et al., 2016). 해당 결과는 삼채뿌리분말 처리로 인한 장내 미생물 균총 변화가 육계 생산성과 건강에 치명적인 영향을 주는 질병을 억제하는 효능을 가질 수 있음을 제시하는 결과라 할 수 있다.

kjps-50-3-171-g2
Fig. 2. Effect of supplementation of AH on the phyla (A), families (B), and genera level (C) compositions of cecal microbial communities in 28-day-old broilers. Proportions of the microbiome represented by less than 1% at the family level and less than 0.5% at the genus level were classified as “Others” category. AH, Allium hookeri.
Download Original Figure

Genus 수준에서는 FaecalibacteriumPhocaeicola은 각각 대조군(27.45%, 6.66%)에 비해 처리군(12.18%, 3.58%)에서 낮았고, EnterococcusGemmiger은 각각 대조군(3.84%, 0.65%)에 비해 처리군(8.36%, 4.54%)에서 높았다(Fig. 2C). Faecalibacterium은 유일하게 F. prausnitzii만 알려져 있는데 해당 균주는 효과적인 butyrate 생산자로써 많은 경제동물의 생균제 후보로 연구되고 있다(Sokol et al., 2008). Enterococcus는 유산균에 속하는 미생물이며 병원성을 띄는 종이 있는 반면 Salmonella 감염으로 인한 장 손상을 유의미하게 개선할 수 있는 종이 있다는 연구결과가 있다(Audisio et al., 2000). 본 실험에서 해당 균주의 증가가 육계의 장관 미생물 환경 개선 및 장관면역향상에 긍정적인 영향을 미치는지 확정하기 어려우므로 해당 미생물이 장관면역에 미치는 영향에 대한 추가적인 연구가 필요한 상황이다.

육계에게 삼채뿌리분말을 급여 시 차등적으로 풍부한 분류군을 가지는 장내 미생물을 찾기 위해 LEfSe분석을 실시하였다. 분석 결과 일부 장내 미생물 균총이 삼채뿌리분말 첨가 시 증가하는 것을 확인하였으며 LDA score 3.0 이상으로 확인된 종으로는 Limosilactobacillus, Cuneatibacter, Ruminococcoides이다(Fig. 3). Limosilactobacillus는 항산화, 항염증 시스템을 유익하게 조절하여 당뇨병 환자의 포도당 항상성을 개선해주는 미생물로 알려져 있다(de Luna Freire et al., 2021). 육계의 경우 Limosilactobacillus는 체중 및 헤모글로빈 함량 및 HDL을 증가시키고 Salmonella 감염에 대해 길항작용을 가지는 생균제 후보로 알려져 있다(Hati et al., 2022). Cuneatibacter는 육계의 장관에서 괴사성 장염이 발생하면 빠르게 없어지는 것으로 알려져 있으며 pyrazine을 생성하는 균주 중 하나인데, pyrazine은 Granulocytes의 산화질소를 감소시키거나 항생 및 항염증 작용을 하는 물질로 알려져 있다(Dolezal and Zitko, 2015; Abdugheni et al., 2022). Ruminococcoides는 담즙저항성을 가진 미생물이며 난분해성 전분을 분해하여 아세테이트 등의 대사산물을 생성할 수 있다(Molinero et al., 2022). 아세테이트와 같은 휘발성 지방산은 육계의 성장과 장내 미생물 군집환경에 도움을 주는 유용물질로 알려져 있다(Bergman, 1990). 전반적으로 사료내 삼채뿌리분말 첨가는 육계의 장내 미생물 군집에서 긍정적인 효과를 나타내는 것으로 보이지만, 장관면역 조절에 있어 해당 미생물의 정확한 역할에 대한 추가적인 연구가 필요할 것이다.

kjps-50-3-171-g3
Fig. 3. Linear discriminant analysis effect (LEfSe) cladogram and linear discriminant analysis (LDA) based on operational taxonomic units were used to differentiate the cecal microbial communities of birds fed experimental diets. (A) Cladogram indicating the phylogenetic distribution of the cecal microbial communities. (B) Linear discriminant analysis (LDA) score bar graph showing microbiome difference between control group and AH group. AH, Allium hookeri.
Download Original Figure
2. 장관면역 분석

사료내 삼채뿌리분말 첨가가 장관면역에 끼치는 영향과 면역세포의 변화에 대해 분석하기 위해 LP 내 면역세포를 분리하여 Flow cytometry 분석을 실시하였다. LP는 장관에 존재하는 느슨하게 조직된 결합조직 층으로, T cell이나 B cell, APC 등 다양하고 많은 양의 면역세포가 존재하는 곳이다. 해당 조직에는 전체 동물 체내의 약 80%에 해당하는 면역세포가 존재한다고 알려져 있어 장관면역뿐 아니라 동물의 전체적인 면역 상태를 분석하기에 적합한 기관이라 할 수 있다(Varol et al., 2009). 본 연구에서 먼저 장관면역세포를 분리 후 장관내 T cell을 비교 분석하였다(Fig. 4). T cell의 바이오마커인 CD3을 이용하여 면역세포에서 전체 T cell 군집을 확인하였다. 그 다음 T cell subset을 분석하기 위하여 CD4를 발현하는 helper T cell을 확인하였고, CD8을 발현하는 cytotoxic T cell, TCRγδ를 발현하는 γδ T cell을 확인하였다. 유세포분석 결과, 삼채뿌리분말 처리군에서 helper T cell이 유의미하게 감소하였으며(P=0.049), cytotoxic T cell과 γδ T cell은 유의미한 차이는 없었다(Fig. 4). 육계의 T cell은 연령에 따라 점차 성숙하고 변화한다. 부화한 지 얼마 안 된 육계의 T cell은 표현형적으로 성숙하고 성체의 T cell과 비슷한 수준의 결합능을 가졌으나 면역자극에 의한 증식이나 사이토카인을 생산하는 기능은 미성숙하다고 알려져 있다(Lowenthal et al., 1994). 또한 육계의 장관내 T cell은 부화하자마자 지속적으로 발달하며 부화 후 14일차 육계의 장관내에서 낮은 수준의 T cell 유래 사이토카인을 보이며 부화 후 28일차까지도 cytotoxic T cell과 같은 특정 세포성면역과 비특이적 세포성 면역이 성숙하지 못했으나 연령이 높아질수록 면역계가 향상됨을 밝힌 연구결과가 있다(Song et al., 2021). T cell은 면역체계에서 중요한 유형의 면역 세포이며 적응면역을 담당하고 T cell 수용체(T cell receptor)를 통해 다양한 병원체를 인식하여 면역반응을 일으킨다. T cell에는 helper T cell, cytotoxic T cell, γδ T cell 등이 존재한다. Helper T cell은 B cell의 분화 및 활성을 돕거나 cytotoxic T cell 및 APC를 활성화하는 역할을 한다(Murphy and Reiner, 2002; Schwartz, 2003; Smith-Garvin et al., 2009). Cytotoxic T cell은 granzyme이나 perforin과 같은 세포독성물질을 통해 감염된 세포나 외부 병원체를 제거하는 면역세포다(Andersen et al., 2006). Cytotoxic T cell은 helper T cell의 명령에 따라 활동하기 때문에 효과적인 면역반응을 위해서는 helper T cell과의 상호작용이 중요하다. 또한 helper T cell과는 역의 상관관계를 가지고 있어 두개의 세포비율을 비교하여 감염이나 질환의 마커로 사용하기도 한다(Skapenko et al., 2005). γδ T cell는 병원균, 기생충 및 바이러스 감염에 대해 항균 활성을 나타내며 사이토카인 생산, 세포 독성 활성, 면역 및 염증 조절 등 광범위한 기능을 수행하는 것으로 알려져 있다(Vantourout and Hayday, 2013). 병원균에 감염된 초생추의 면역활성에서 γδ T cell이 증가하여 면역반응에 도움을 준다는 연구결과가 있다(Alkie et al., 2019). T cell 분화 시 cytotoxic T cell과 γδ T cell로의 분화는 상대적으로 CD4+ T cell의 분화 감소로 이어질 수 있으나 CD4+ T cell 감소의 직접적인 원인과 이러한 변화가 장관면역 항상성 유지에 끼치는 영향에 대해서는 추가적인 연구가 필요할 것으로 보인다.

kjps-50-3-171-g4
Fig. 4. Changes in the populations of T cells in the small intestine of 28-day-old broilers fed a control diet or a diet containing AH. Each data point represents six replicates and is presented as means±S.D. Significant differences between treatments were analyzed by a two-tailed unpaired t-test. * Indicate significance at P<0.05. AH, Allium hookeri.
Download Original Figure

APC는 적응 면역의 중요한 부분을 담당하며 주요 조직 적합성 복합체(Major histocompatibility complex; MHC)를 통해 항원을 제시하는 세포이다(Alkie et al., 2019). APC는 전문성 또는 비전문성으로 나누어지는데 MHC II를 발현하는 세포를 전문성 APC라 불린다. 전문성 APC에는 대식세포, B cell 및 수지상세포가 있다. 전문성 APC는 항원을 T cell에 제시하는데 특화되어 있으며 식균작용과 수용체 매개 세포내섭취(Receptor-mediated endocytosis)가 뛰어나므로 장내 면역계에 중요한 역할을 담당한다(Kambayashi and Laufer, 2014; Mann and Li, 2014). B cell은 림프구 중에서 항원에 대한 항체를 생성하고 일부 B cell은 기억세포로 분화하여 같은 항원에 감염되었을 때 보다 빠르게 항원에 대응하는 역할을 한다(Hardy and Hayakawa, 2001). 대식세포는 육계의 장관면역에서 수지상 세포와 함께 항원제시를 통해 T cell 및 B cell의 활성화에 필수적인 역할을 할 뿐 아니라 IFNγ를 생산하여 대식세포의 식세포 작용과 Th1의 반응을 촉진시켜 육계의 장관면역력을 증가시킨다(Gutcher and Becher, 2007). 본 연구에서는 APC의 대표적 바이오마커인 MHC II를 이용하여 전체 면역세포에서 APC를 확인하였으며, 추가적으로 Bu-1과 Mono/Mac을 이용하여 각각 B cell과 대식세포를 확인하였다. 분석 결과 B cell과 대식세포는 대조군에 비해 삼채뿌리분말 처리군에서 유의미한 차이를 나타내지 않았다(Fig. 5).

kjps-50-3-171-g5
Fig. 5. Changes in the populations of antigen-processing cells in the small intestine of 28-day-old broilers fed a control diet or a diet containing AH. Each data point represents six replicates and is presented as means±S.D. Significant differences between treatments were analyzed by a two-tailed unpaired t-test. AH, Allium hookeri.
Download Original Figure
3. 사이토카인 및 항산화기능 관련 유전자 발현

사료내 삼채뿌리분말 첨가가 육계의 장관 조직에서 사이토카인 및 항산화기능 관련 유전자 발현에 어떤 영향을 주는지 구명하기 위해 qRT-PCR 분석을 실시하였다. 본 연구에서 사료내 삼채뿌리분말 첨가가 육계 장관내 사이토카인 관련 유전자에 영향을 주는지 확인한 결과, 사이토카인 관련 유전자 발현에는 유의미한 차이를 관찰하지는 못하였다(Fig. 6A).

kjps-50-3-171-g6
Fig. 6. The expression of gut immunity and gut health-related genes in small intestine tissue of birds fed diet containing AH. Each data point represents six replicates and is presented as means±S.D. Significant differences between treatments were analyzed by a two-tailed unpaired t-test. Significant differences between treatments were analyzed by a two-tailed unpaired t-test. # Indicate tendency at 0.05<P<0.1. AH, Allium hookeri.
Download Original Figure

사이토카인은 세포신호 전달에 중요한 역할을 하는 단백질로 이루어진 면역조절물질이다. 사이토카인은 대식세포, 수지상세포, T cell 및 B cell 등 다양한 세포에 의해 생성되며 구조 및 기능에 따라 분류한다. 기능에 따라 사이토카인은 전염증성 사이토카인과 항염증성 사이토카인으로 분류할 수 있는데 염증성 사이토카인은 세포면역반응을 강화함과 동시에 만성 염증이나 세포의 산화스트레스를 증가시켜 면역계에 악영향을 미치기도 한다(Dinarello, 2000; Oppenheim, 2001). 인터루킨(Interleukin, IL)은 다양한 세포에서 발현되고 분비되는 사이토카인이다. 면역계 기능의 대부분은 IL에 의존하고 있으며 각 기능에 따라 종류가 세분화되어있다(Mocellin et al., 2005; Gabay, 2006; Brocker et al., 2010; Bent et al., 2018). IL은 원활한 면역 항상성 유지에 반드시 필요하지만, 과잉 혹은 결핍으로 인한 면역질환을 일으키기도 한다. 본 연구에서 확인한 사이토카인 유전자는 대표적인 염증성 및 항염증성 기능을 가진 IL1b, IL6, IL10이다(Kaiser et al., 2004). IL1b 및 IL6는 일반적으로 전염증성 사이토카인으로 불리며 항원에 대한 저항과 반응에 중요하며, 장 상피세포와 장내 미생물의 상호작용에 관여하여 장관면역 향상에 도움을 주는 것으로 알려져 있다. 그러나 체내에 과잉생산 될 경우 발열 및 장내 조직손상, 염증을 일으켜 장관면역에 영향을 준다고 알려져 있다(Prakasam et al., 2013). IL10은 사이토카인 합성 억제 인자로도 알려져 있는 대표적 항염증 사이토카인이다(Moore et al., 1993). 육계의 장관내에서 IL10은 염증을 감소시키며 선천면역세포의 활성을 감소시켜 숙주 조직의 추가 염증을 방지하지만, IL10의 과발현은 오히려 장관내 병원체가 숙주 면역 반응을 회피할 수 있도록 한다(de Waal Malefyt et al., 1991; Arendt et al., 2016). 따라서 IL1b, IL6 및 IL10과 같은 사이토카인은 장관내에서 적절한 수준으로 조절되어야 한다.

본 연구에서 사료내 삼채뿌리분말 첨가가 육계 장관내 항산화기능 관련 유전자에 영향을 주는지 확인한 결과, 항산화기능 관련 유전자 중 GPX2 발현이 증가하는 경향을(P=0.060) 관찰하였다(Fig. 6B). 산소를 이용하는 모든 생체의 세포는 활동하면서 활성산소(Reactive oxygen species)를 생성하는데 이는 장관내 조직을 손상시키며 장건강에 부정적인 영향을 끼칠 수 있다(Li et al., 2003). 이러한 장관내 산화 스트레스를 감소시키기 위해 SOD1, CAT, GPX2와 같은 항산화효소를 생성한다. 육계 장관의 항산화 효과에 대해 사료내 식물유래 성분의 추가가 긍정적인 효과가 있음이 잘 알려져 있으며(Mishra and Jha, 2019), 사료내 삼채뿌리분말 첨가도 육계의 장건강에 긍정적인 효과를 나타낼 수 있는 것으로 볼 수 있다.

본 연구를 통해 육계에서 삼채뿌리분말이 첨가된 사료를 급여 시 장내 잠재적 유익균의 증가와 잠재적 병원균 속의 감소 등 장내 미생물 균총의 변화에서 긍정적인 효과를 확인하였고 장관면역세포인 T cell subset의 분포에 영향을 미침을 확인하였다. 또한 사이토카인 및 항산화기능 관련 유전자 발현에서는 GPX2가 증가하는 경향성을 확인하였다. 이는 육계 사료내 삼채뿌리분말 첨가가 육계의 장내미생물을 긍정적인 방향으로 개선하여 장관면역이나 장건강을 향상시킬 수 있는 사료첨가제로 사용할 가능성이 있음을 나타낸다.

사 사

본 논문은 농촌진흥청 연구사업(연구번호: RS-2021-RD 010035)의 지원에 의해 이루어진 것임.

References

1.

Abdugheni R, Wang WZ, Wang YJ, Du MX, Liu FL, Zhou N, Jiang CY, Wang CY, Wu L, Ma J 2022 Metabolite profiling of human-originated Lachnospiraceae at the strain level. Imeta 1(4):e58.

2.

Alkie TN, Yitbarek A, Hodgins DC, Kulkarni RR, Taha-Abdelaziz K, Sharif S 2019 Development of innate immunity in chicken embryos and newly hatched chicks: a disease control perspective. Avian Pathol 48(4):288-310.

3.

An SH, Joo SS, Lee HG, Kim ZH, Lee CS, Kong C, Kim M 2020 Supplementation of indigenous green microalga (Parachlorella sp.) to pre-starter diet for broiler chickens. Korean J Poult Sci 47(1):49-59.

4.

Andersen MH, Schrama D, thor Straten P, Becker JC 2006 Cytotoxic T cells. J Invest Dermatol 126(1):32-41.

5.

Arendt MK, Sand JM, Marcone TM, Cook ME 2016 Interleukin-10 neutralizing antibody for detection of intestinal luminal levels and as a dietary additive in Eimeria challenged broiler chicks. Poult Sci 95(2):430-438.

6.

Audisio MC, Oliver G, Apella MC 2000 Protective effect of Enterococcus faecium J96, a potential probiotic strain, on chicks infected with Salmonella Pullorum. J Food Prot 63(10):1333-1337.

7.

Aviagen 2019 Ross 308 performance objectives. https://en.aviagen.com/assets/Tech_Center/Ross_Broiler/Ross308-308FF-BroilerPO2019-EN.pdf. Accessed on January 12, 2022.

8.

Bent R, Moll L, Grabbe S, Bros M 2018 Interleukin-1 beta-a friend or foe in malignancies? Int J Mol Sci 19(8):2155.

9.

Bergman E 1990 Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol Rev 70(2):567-590.

10.

Brocker C, Thompson D, Matsumoto A, Nebert DW, Vasiliou V 2010 Evolutionary divergence and functions of the human interleukin (IL) gene family. Hum Genom 5(1):1-26.

11.

Chase CC 2018 Enteric immunity: happy gut, healthy animal. Vet Clin North Am Food Anim Pract 34(1):1-18.

12.

Choct M 2009 Managing gut health through nutrition. Br Poult Sci 50(1):9-15.

13.

Chung H, Pamp SJ, Hill JA, Surana NK, Edelman SM, Troy EB, Reading NC, Villablanca EJ, Wang S, Mora JR 2012 Gut immune maturation depends on colonization with a host-specific microbiota. Cell 149(7):1578-1593.

14.

Crhanova M, Hradecka H, Faldynova M, Matulova M, Havlickova H, Sisak F, Rychlik I 2011 Immune response of chicken gut to natural colonization by gut microflora and to Salmonella enterica serovar enteritidis infection. Infect Immun 79(7):2755-2763.

15.

de Luna Freire MO, do Nascimento LCP, de Oliveira KÁR, de Oliveira AM, dos Santos Lima M, Napoleão TH, da Costa Silva JH, Lagranha CJ, de Souza EL, de Brito Alves JL 2021 Limosilactobacillus fermentum strains with claimed probiotic properties exert anti-oxidant and anti-inflammatory properties and prevent cardiometabolic disorder in female rats fed a high-fat diet. Probiotics Antimicrob Proteins 15:601-613.

16.

de Waal Malefyt R, Abrams J, Bennett B, Figdor CG, de Vries JE 1991 Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med 174(5):1209-1220.

17.

Deka B, Barge SR, Bharadwaj S, Kashyap B, Manna P, Borah JC, Talukdar NC 2021 Beneficial effect of the methanolic leaf extract of Allium hookeri on stimulating glutathione biosynthesis and preventing impaired glucose metabolism in type 2 diabetes. Arch Biochem Biophys 708:108961.

18.

Dinarello CA 2000 Proinflammatory cytokines. Chest 118(2): 503-508.

19.

Dolezal M, Zitko J 2015 Pyrazine derivatives: a patent review (June 2012-present). Expert Opin Ther Pat 25(1):33-47.

20.

El-Sharkawy H, Tahoun A, Rizk AM, Suzuki T, Elmonir W, Nassef E, Shukry M, Germoush MO, Farrag F, Bin-Jumah M 2020 Evaluation of Bifidobacteria and Lactobacillus probiotics as alternative therapy for Salmonella typhimurium infection in broiler chickens. Animals 10(6):1023.

21.

Fasina YO, Newman MM, Stough JM, Liles MR 2016 Effect of Clostridium perfringens infection and antibiotic administration on microbiota in the small intestine of broiler chickens. Poult Sci 95(2):247-260.

22.

Gabay C 2006 Interleukin-6 and chronic inflammation. Arthritis Res Ther 8(2):1-6.

23.

Gong J, Forster RJ, Yu H, Chambers JR, Wheatcroft R, Sabour PM, Chen S 2002 Molecular analysis of bacterial populations in the ileum of broiler chickens and comparison with bacteria in the cecum. FEMS Microbiol Ecol 41(3):171-179.

24.

Gordon J, Manley NR 2011 Mechanisms of thymus organogenesis and morphogenesis. Development 138(18):3865-3878.

25.

Gutcher I, Becher B 2007 APC-derived cytokines and T cell polarization in autoimmune inflammation. J Clin Invest 117(5):1119-1127.

26.

Hardy RR, Hayakawa K 2001 B cell development pathways. Annu Rev Immunol 19(1):595-621.

27.

Hati S, Ramanuj K, Basaiawmoit B, Koringa P, Desai M, Ghodasara DJ, Joshi KV, Pathan M, V S, Bhagora NJ 2022 Significance of Limosilactobacillus fermentum and Saccharomyces cerevisiae on the growth performance, haematological traits, serum biochemistry, faecal and caeca microbiota of broiler chickens. J Am Nutr Assoc 30:1-20.

28.

Heres L, Engel B, Urlings H, Wagenaar J, Van Knapen F 2004 Effect of acidified feed on susceptibility of broiler chickens to intestinal infection by Campylobacter and Salmonella. Vet Microbiol 99(3-4):259-267.

29.

Jandhyala SM, Talukdar R, Subramanyam C, Vuyyuru H, Sasikala M, Reddy DN 2015 Role of the normal gut microbiota. World J Gastroenterol 21(29):8787.

30.

Joo SS, Yoon JH, Jung JY, Joo SY, An SH, Ban BC, Kong C, Kim M 2022 The modulatory effects of Lacticaseibacillus paracasei strain NSMJ56 on gut immunity and microbiome in early-age broiler chickens. Animals 12(23):3413.

31.

Kaiser P, Rothwell L, Goodchild M, Bumstead N 2004 The chicken proinflammatory cytokines interleukin-1β and interleukin-6: differences in gene structure and genetic location compared with their mammalian orthologues. Anim Genet 35(3):169-175.

32.

Kambayashi T, Laufer TM 2014 Atypical MHC class II-expressing antigen-presenting cells: can anything replace a dendritic cell? Nat Rev Immunol 14(11):719-730.

33.

Khan RU, Fatima A, Naz S, Ragni M, Tarricone S, Tufarelli V 2022 Perspective, opportunities and challenges in using fennel (Foeniculum vulgare) in poultry health and production as an eco-friendly alternative to antibiotics: a review. Antibiotics 11(2):278.

34.

Kim B, Lindemann M 2007 A spreadsheet method for experimental animal allotment. Page 112 In: Journal of Animal Science. Amer Soc Animal Science 1111 North Dunlap Ave, Savoy, Il 61874 USA.

35.

Kober AH, Riaz Rajoka MS, Mehwish HM, Villena J, Kitazawa H 2022 Immunomodulation potential of probiotics: a novel strategy for improving livestock health, immunity, and productivity. Microorganisms 10(2):388.

36.

Kothari D, Lee WD, Niu KM, Kim SK 2019 The genus Allium as poultry feed additive: A review. Animals 9(12):1032.

37.

Kwak MJ, Park MY, Sung KP, Lee H, Whang KY, Kim Y 2022 Dietary effects of sophorolipids on nutrient bioavailability and intestinal microenvironments in broiler chickens. J Anim Sci Technol 64(6):1092-1104.

38.

Lan Y, Verstegen M, Tamminga S, Williams B 2005 The role of the commensal gut microbial community in broiler chickens. World’s Poult Sci J 61(1):95-104.

39.

Lee SH, Bang S, Jang HH, Choe JS, Lee EB, Choi JH, Park SY, Kim HJ, Lillehoj HS 2019 Effects of Allium hookeri leaf and root on gut microbiome related to growth performance of young broiler chickens. Pages 396-397 In: 2019 KFN International Symposium and Annual Meeting, The Korean Society of Food Science and Nutrition, Jeju Island, Seogwipo.

40.

Lee SH, Bang S, Jang HH, Lee EB, Kim BS, Kim SH, Kang SH, Lee KW, Kim DW, Kim JB 2020 Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickens. PLoS One 15(1):e0226833.

41.

Lee Y, Lee SH, Gadde U, Oh S, Lee S, Lillehoj H 2018 Allium hookeri supplementation improves intestinal immune response against necrotic enteritis in young broiler chickens. Poult Sci 97(6):1899-1908.

42.

Lee Y, Lee SH, Jeong MS, Kim JB, Jang HH, Jeong SC, Kim DW, Lillehoj HS 2017 In Vitro analysis of the immunomodulating effects of Allium hookeri on lymphocytes, macrophages, and tumour cells. J Poult Sci 54(2):142-148.

43.

Li N, Ragheb K, Lawler G, Sturgis J, Rajwa B, Melendez JA, Robinson JP 2003 Mitochondrial complex I inhibitor rotenone induces apoptosis through enhancing mitochondrial reactive oxygen species production. J Biol Chem 278(10): 8516-8525.

44.

Lowenthal JW, Connick T, McWATERS PG, York JJ 1994 Development of T cell immune responsiveness in the chicken. Immunol Cell Biol 72(2):115-122.

45.

Mann ER, Li X 2014 Intestinal antigen-presenting cells in mucosal immune homeostasis: crosstalk between dendritic cells, macrophages and B-cells. World J Gastroenterol 20(29):9653.

46.

Martin M 2011 Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J 17(1):10-12.

47.

Mishra B, Jha R 2019 Oxidative stress in the poultry gut: potential challenges and interventions. Front Vet Sci 6:60.

48.

Mocellin S, Marincola FM, Young HA 2005 Interleukin-10 and the immune response against cancer: a counterpoint. J Leukoc Biol 78(5):1043-1051.

49.

Molinero N, Conti E, Walker AW, Margolles A, Duncan SH, Delgado S 2022 Survival strategies and metabolic interactions between Ruminococcus gauvreauii and Ruminococcoides bili, isolated from human bile. Microbiol Spectr 10(4):e02776-02721.

50.

Moore KW, O’Garra A, Malefyt RW, Vieira P, Mosmann TR 1993 Interleukin-10. Annu Rev Immunol 11(1):165-190.

51.

Morrison DJ, Preston T 2016 Formation of short chain fatty acids by the gut microbiota and their impact on human metabolism. Gut microbes 7(3):189-200.

52.

Mu C, Zhao Q, Zhao Q, Yang L, Pang X, Liu T, Li X, Wang B, Fung SY, Cao H 2023 Multi-omics in Crohn’s disease: new insights from inside. Comput Struct Biotechnol J 21:3054-3072.

53.

Murphy KM, Reiner SL 2002 The lineage decisions of helper T cells. Nat Rev Immunol 2(12):933-944.

54.

O’Hara E, Neves AL, Song Y, Guan LL 2020 The role of the gut microbiome in cattle production and health: driver or passenger? Annu Rev Anim Biosci 8:199-220.

55.

Oppenheim JJ 2001 Cytokines: past, present, and future. Int J Hematol 74:3-8.

56.

Pessione E 2012 Lactic acid bacteria contribution to gut microbiota complexity: lights and shadows. Front Cell Infect Microbiol 2:86.

57.

Prakasam R, Fujimoto M, Takii R, Hayashida N, Takaki E, Tan K, Wu F, Inouye S, Nakai A 2013 Chicken IL-6 is a heat-shock gene. FEBS lett 587(21):3541-3547.

58.

Rehman HU, Vahjen W, Awad WA, Zentek J 2007 Indigenous bacteria and bacterial metabolic products in the gastrointestinal tract of broiler chickens. Arch Anim Nutr 61(5):319-335.

59.

Rim CY, Jung H, An SH, Joo SS, Kim ZH, Kong C, Kim M 2022 Supplementation of microalgae (Tetradesmus sp.) to pre-starter diet for broiler chickens. Korean J Poult Sci 49(2):125-137.

60.

Rooks MG, Garrett WS 2016 Gut microbiota, metabolites and host immunity. Nat Rev Immunol 16(6):341-352.

61.

Rossi M, Martínez-Martínez D, Amaretti A, Ulrici A, Raimondi S, Moya A 2016 Mining metagenomic whole genome sequences revealed subdominant but constant Lactobacillus population in the human gut microbiota. Environ Microbiol Rep 8(3):399-406.

62.

Rubio LA 2019 Possibilities of early life programming in broiler chickens via intestinal microbiota modulation. Poult Sci 98(2):695-706.

63.

Rychlik I 2020 Composition and function of chicken gut microbiota. Animals 10(1):103.

64.

Schwartz RH 2003 T cell anergy. Annu Rev Immunol 21(1):305-334.

65.

Segura-Wang M, Grabner N, Koestelbauer A, Klose V, Ghanbari M 2021 Genome-resolved metagenomics of the chicken gut microbiome. Front Microbiol 12:726923.

66.

Sharifi-Rad J, Mnayer D, Tabanelli G, Stojanović-Radić Z, Sharifi-Rad M, Yousaf Z, Vallone L, Setzer W, Iriti M 2016 Plants of the genus Allium as antibacterial agents: from tradition to pharmacy. Cell Mol Biol 62(9):57-68.

67.

Skapenko A, Leipe J, Lipsky PE, Schulze-Koops H 2005 The role of the T cell in autoimmune inflammation. Arthritis Res Ther 7(2):S4-S14.

68.

Smith-Garvin JE, Koretzky GA, Jordan MS 2009 T cell activation. Annu Rev Immunol 27:591-619.

69.

Sokol H, Pigneur B, Watterlot L, Lakhdari O, Bermúdez-Humarán LG, Gratadoux JJ, Blugeon S, Bridonneau C, Furet JP, Corthier G 2008 Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn disease patients. Proc Natl Acad Sci U S A 105(43):16731-16736.

70.

Song B, Tang D, Yan S, Fan H, Li G, Shahid MS, Mahmood T, Guo Y 2021 Effects of age on immune function in broiler chickens. J Anim Sci Biotechnol 12:1-12.

71.

Sugiharto S 2016 Role of nutraceuticals in gut health and growth performance of poultry. J Saudi Soc Agric Sci 15(2):99-111.

72.

Sun J, Liao XP, D’Souza AW, Boolchandani M, Li SH, Cheng K, Luis Martínez J, Li L, Feng YJ, Fang LX 2020 Environmental remodeling of human gut microbiota and antibiotic resistome in livestock farms. Nat Commun 11(1):1427.

73.

Van Boeckel TP, Brower C, Gilbert M, Grenfell BT, Levin SA, Robinson TP, Teillant A, Laxminarayan R 2015 Global trends in antimicrobial use in food animals. Proc Natl Acad Sci U S A 112(18):5649-5654.

74.

Vantourout P, Hayday A 2013 Six-of-the-best: unique contributions of γδ T cells to immunology. Nat Rev Immunol 13(2):88-100.

75.

Varol C, Vallon-Eberhard A, Elinav E, Aychek T, Shapira Y, Luche H, Fehling HJ, Hardt WD, Shakhar G, Jung S 2009 Intestinal lamina propria dendritic cell subsets have different origin and functions. Immunity 31(3):502-512.

76.

Wei S, Morrison M, Yu Z 2013 Bacterial census of poultry intestinal microbiome. Poult Sci 92(3):671-683.

77.

Wessels K, Rip D, Gouws P 2021 Salmonella in chicken meat: consumption, outbreaks, characteristics, current control methods and the potential of bacteriophage use. Foods 10(8):1742.

78.

Wynn JL, Levy O 2010 Role of innate host defenses in susceptibility to early-onset neonatal sepsis. Clin Perinatol 37(2):307-337.

79.

Yang Q, Liu J, Robinson KJ, Whitmore MA, Stewart SN, Zhang G 2021 Perturbations of the ileal mycobiota by necrotic enteritis in broiler chickens. J Anim Sci Biotechnol 12(1):107.

80.

Zhang L, Zhang R, Jia H, Zhu Z, Li H, Ma Y 2021 Supplementation of probiotics in water beneficial growth performance, carcass traits, immune function, and antioxidant capacity in broiler chickens. Open Life Sci 16(1):311-322.

[공지] 한국가금학회 학술지 영문화 전환 및 논문 투고 안내


안녕하십니까, 한국가금학회 편집위원회입니다.

저희 한국가금학회는 학술지의 국제적 위상 제고와 연구 성과의 폭넓은 공유를 위해,
2025년 11월 정기총회에서 영문 학술지로의 전환을 결정한 바 있습니다.

앞으로 본 학술지는 모든 투고 논문을 영문으로 작성하여 접수받으며,
국제적인 심사 기준을 통해 고품질의 연구를 게재하고자 합니다.

새로운 도약을 위한 이번 변화에 회원 및 연구자 여러분의 적극적인 관심과 투고를 부탁드립니다.

 

1. 주요 변경 사항
 · 투고 언어: 전면 영문
 · 적용 시기: 2026년 5월 투고분부터

 

2. 학술지명 변경
 · 기존: 한국가금학회지, Korean Journal of Poultry Science
 · 변경: Poultry Science and Biotechnology

 

3. 논문 투고 및 심사 안내
 · 투고처: https://www.ekjps.org (온라인 논문 투고 시스템 링크 )
 · 투고 규정: 새로운 영문 템플릿 준수
 · 문의: 편집위원장

 

더욱 발전된 모습으로 학문 교류의 장이 될 수 있도록 최선을 다하겠습니다.

 

감사합니다.

 

(사)한국가금학회 회장 민원기 올림

(사)한국가금학회 편집위원장 허정민 올림


I don't want to open this window for a day.