Article

Molecular Signatures in Chicken Lungs Infected with Avian Influenza Viruses

Jeong Woong Park1https://orcid.org/0000-0003-0885-3078, Marc Ndimukaga2https://orcid.org/0000-0001-8061-7753, Jaeyoung Heo3,https://orcid.org/0000-0002-9721-8043, Ki-Duk Song4,https://orcid.org/0000-0003-2827-0873
Author Information & Copyright
1Postdoctral Researcher, Department of Animal Biotechnology, College of Agricultural and Life Sciences, Jeonbuk National University, Jeonju 54896, Republic of Korea
2Graduate Student, Department of Animal Biotechnology, College of Agricultural and Life Sciences, Jeonbuk National University, Jeonju 54896, Republic of Korea
3Professor, Department of Animal Biotechnology, Jeonbuk National University, Jeonju 54896, Republic of Korea
4Professor, Department of Agricultural Convergence Technology, Jeonbuk National University, Jeonju 54896, Republic of Korea
To whom correspondence should be addressed : jyheo@jbnu.ac.kr, kiduk.song@jbnu.ac.kr

© Copyright 2023, Korean Society of Poultry Science. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Jul 19, 2023; Revised: Oct 02, 2023; Accepted: Oct 07, 2023

Published Online: Dec 31, 2023

Abstract

Influenza IAVs are encapsulated negative-strand RNA viruses that infect many bird species' respiratory systems and can spread to other animals, including humans. This work reanalyzed previous microarray datasets to identify common and specific differentially expressed genes (DEGs) in chickens, as well as their biological activities. There were 760 and 405 DEGs detected in HPAIV and LPAIV-infected chicken cells, respectively. HPAIV and LPAIV have 670 and 315 DEGs, respectively, with both viruses sharing 90 DEGs. Because of HPAIV infection, numerous genes were implicated in a fundamental biological function of the cell cycle, according to the functional annotation of DEGs. Of the targeted genes, expressions of CDC Like Kinase 3 (CLK3), Nucleic Acid Binding Protein 1 (NABP1), Interferon-Inducible Protein 6 (IFI6), PIN2 (TERF1) Interacting Telomerase Inhibitor 1 (PINX1), and Cellular Communication Network Factor 4 (WISP1) were altered in DF-1 cells treated with polyinosinic:polycytidylic acid (PIC), a toll-like receptor 3 (TLR3) ligand, suggesting that transcription of these genes be controlled by TLR3 signaling. To gain a better understanding of the pathophysiology of AIVs in chickens, it is crucial to focus more research on unraveling the mechanisms through which AIV infections may manipulate host responses during the infection process. Insights into these mechanisms could facilitate the development of novel therapeutic strategies.

Keywords: avian influenza virus; chickens; differentially expressed genes; DF-1 cells; lung; toll-like receptor 3 signaling

INTRODUCTION

Influenza IAVs are enveloped negative-strand RNA viruses that affect the respiratory systems of many bird species and can be transferred to other animals, including humans, resulting in global epidemics and pandemics (Wang et al., 2012). The surface proteins hemagglutinin (HA) and neuraminidase (NA), of which there are currently 18 HA and 11 NA subtypes, give IAVs their names (Evseev and Magor, 2019). Avian influenza viruses are classed as either low pathogenic avian influenza (LPAI) or high pathogenic avian influenza (HPAI) based on the combinations of HA and NA (Swayne, 2009; Kim et al., 2017). The majority of HPAIV mutants are low pathogenic H5 and H7 subtypes that become fatal to most gallinaceous birds, while the low pathogenic is mild or asymptomatic (Smith et al., 2015; Roy Chowdhury et al., 2019). Most importantly, the capacity of IAV to elude the host immune system has been related to its severity in chickens (Hogg, 2016; Qi et al., 2017; May et al., 2018).

Despite the fact that LPAIV is asymptomatic in most domestic and wild waterfowl species, it has been shown to produce clinical signs and lesions in chickens that are very similar to HPAIV in the early stages of infection, as a result of pathophysiological damage to the respiratory, digestive, and reproductive systems (Pantin-Jackwood and Swayne, 2009; Kuchipudi et al., 2014).

The economic burden imposed by HPAIV, and to a lesser extent LPAIV, on the poultry industry is enormous, but it also poses a threat to human health because it is zoonotic. HPAIV H5N1 cases involving human health occur on occasion (Plague and Aviaire, 2006), and the World Health Organization has reported 860 confirmed cases and 454 deaths between 2003 and 2018. (Organization, 2018). In total, 7,122 HPAI outbreaks occurred in 68 countries between January 2013 and August 2018, killing approximately 122 million birds (OIE, 2018).

Despite reported similarities in HPAIV and LPAIV pathogenesis in their early stages of infection, few studies have been done on the comparison of the host-pathogen interaction and the molecular mechanisms underlying the pathogenesis of HPAIV H5N1 and LPAIV H3N2 infection in chickens, and the studies that have been done so far have covered a limited number of target genes (Ranaware et al., 2016).

To gain a better knowledge of virus-host interactions, more information on the target genes of the two viral infections in chickens is needed. This study sought to provide insight into common target genes from differentially expressed genes (DEGs) and their biological functions as a result of host-IAV interactions in chickens using microarray datasets from a previous study (Kuchipudi et al., 2014), which is important information for the development of novel therapeutic strategies.

MATERIALS AND METHODS

1. Microarray Data Acquisition and Gene Expression Profiling

Reanalysis of microarray data from two different influenza virus strains was performed in this study. The study specifically reevaluated data from a LPAI H2N3 virus strain known as A/mallard duck/England/7277/06 and a typical HPAI H5N1 virus strain known as A/turkey/England/50-92/91 or H5N1 50-92. These datasets were created as part of a previous study that looked at changes in gene expression in chickens and ducks after infection with the Influenza A Virus (IAV). The virus strains were chosen based on their pathogenicity in chickens, with LPAI H2N3 being a mild form and HPAI H5N1 indicating a severe and deadly version (Kuchipudi et al., 2014).

For microarray analysis, duplicate RNA samples from chicken cells infected with viruses and mock infected were employed, and a total of 6 array chips (2 viruses, 1 chicken duplicate, 2 controls) were used in the present study. HPAI H5N1 50-92, LPAI (H2N3), and control datasets were used (Table 1).

Table 1. Designs used in microarray image analysis using R ‘limma’ package
Species Sample accession no. (GSM) Case
Chicken GSM825784 LPAI H2N3
GSM825785
GSM825786 HPAI H5N1 50-92
GSM825787
GSM825790 Mock-infected control
GSM825791
Download Excel Table
2. Identification and Functional Analysis of Differentially Expressed Genes (DEGs)

The analysis of microarray images was conducted following the methods detailed in a previous study by Won et al. (2017). In summary, the R program 'limma' was employed for the normalization and quality assessment of microarray images. Adaptive background correction was applied to adjust the median signal intensities, and the LOWESS (locally-weighted scatterplot smoothing) technique, as outlined by Ritchie et al. (2007), was utilized for standardization. Subsequently, log2-transformed fold changes and their associated standard errors were computed using a linear model, and empirical Bayes statistics were employed to enhance the smoothing of standard errors. Differentially expressed genes (DEG) were filtered using a false discovery rate (FDR) cutoff of 0.05 and a two-sample t-test adjusted P-value. The Database for Annotation, Visualization and Integrated Discovery (DAVID), a web-based functional annotation tool, was used to further examine gene expression patterns (https://david.ncifcrf.gov/).

3. Cell Culture, Total RNA Extraction and cDNA Synthesis

Chicken embryo fibroblast DF-1 cells, a spontaneously immortalized continuous cell line derived from an East Lansing Line 0 (ev-0), were routinely cultured in high glucose Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and maintained at 37°C and 5% CO2. To induce toll-like receptor 3 signaling, the cells were washed once in phosphate buffered saline (PBS) before being treated with polyinosinic:polycytidylic acid (PIC). Total RNA was extracted from DF-1 cells using Trizol (Invitrogen, Carlsbad, CA, USA). A NanoDrop spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used to measure total RNA.

4. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)

The nucleotide sequences of chicken candidate genes from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) and the Ensembl Genome Browser (http://www.ensembl.org) were retrieved. The primers for amplification of the genes (Table 2) were designed using PRIMER3 software (http://bioinfo.ut.ee/primer3-0.4.0/).

Table 2. Primer sets used in this study
Primer name Primer sequence (5′ to 3′) Tm (°C) Product size (bp)
CLK3 F CTCCGAACGCTGAGGGG 60 176
CLK3 R AAGGCATCCTGTCATGGCTC - -
IFI6 F GCCGGTTTCACTTCCTCTGG 60 80
IFI6 R CCCCCAAAGGATTTTGCCTC - -
NABP1 F CTAGCTGCCATGTGGTAGGG 60 78
NABP1 R GGGTCCTGCAACTGCACTAT - -
PINX1 F AGAGGAAGGCCCCCAAGAT 60 137
PINX1 R GGACCAGCCCATCTTTTCCA - -
WISP1 F GATTGCTCTGCATTCCCGAAA 60 205
WISP1 R GTCCGTGTGTAGGCCTCTTT - -
GAPDH F TGCTGCCCAGAACATCATCC 60 142
GAPDH R ACGGCAGGTCAGGTCAACAA - -
Download Excel Table

To confirm the differential expression of target genes, 14 upregulated common DEGs and 2 downregulated common DEGs were subjected to a reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The expressions of the selected genes were analyzed using a CFX-96 RT-PCR detection system (BioRad, Hercules, CA, USA). The sequences of forward and reverse primers are presented in Table 2. The PCR conditions were as follows: an initial step of 94°C for 3 min; 39 cycles of 94°C for 10 s, 60°C for 30 s, and 72°C for 30 s; and a final step of 72°C for 10 min. Dissociation was performed at 0.5°C increments from 55°C to 95°C over 25 min. All samples were measured in triplicate to ensure reproducibility, and Ct values were calculated by the 2–ΔΔCt method [24]. The GAPDH gene expression was utilized as a standard.

5. Statistical Analysis

To determine significance levels, the t-test and analysis of variance statistical tests were used. Data were presented as mean standard error of mean. Duncan multiple range tests, followed by one-way ANOVA, were used to compare different incubation times in each group.

RESULTS

1. Identification of Differentially Expressed Genes

We used six microarray datasets from a previous work by Kuchipudi et al. (2014) in the present study. These datasets were used to search for DEGs in chicken lung cells that had been infected with either HPAIV or LPAIV. Our initial goal was to identify the shared and unique transcriptome features elicited by these two virus strains, in order to acquire a better understanding of the molecular mechanisms underlying their pathogenicity in infected chickens. The study uncovered 760 DEGs for HPAIV infection and 405 DEGs for LPAIV infection. Six hundred DEGs were identified to be specific to HPAIV, 317 to LPAIV, and 90 to be common to both. Of the identified DEGs, 521 for HPAIV, 232 for LPAIV and 76 common for both viral strains were up regulated while 151 for HPAIV, 85 for LPAIV and 12 common for both were down regulated (Fig. 1, Supplementary Table S1). It is of note that among DEGs, minichromosome maintenance 9 homologous recombination repair factor 9 (MCM9), was the most positively regulated with 15,709-fold change in HPAIV infected lungs, while Heterogeneous nuclear ribonucleoprotein D Like (HNRNPDL) was the most negatively regulated with -594-fold change. In LPAIV infected lungs, integrator complex subunit 6 (INTS6), was the most positively regulated with 2713-fold change, while sodium voltage-gated channel alpha subunit 8 (SCN8A) was the most negatively regulated with -24476-fold change.

kjps-50-4-193-g1
Fig. 1. Venn diagram showing shared and unique DEGs in responses to LPAIV and HPAIV infection in chickens. (A) Venn diagram showing shared and unique DEGs in responses to LPAIV and HPAIV infection in chickens. (B) The number of differentially expressed genes in LPAIV, HPAIV and Overlapped DEGs between LPAIV and HPAIV.
Download Original Figure
2. Gene Ontology (GO) Analyses

Functional annotation with DAVID revealed that in HPAIV and LPAIV infected lungs, 11 and 9 biological process (BP) terms were substantially enriched, respectively (P<0.05, Fig. 2A and 2B, Supplementary Table S2). ‘Regulation of transcription, DNA-templated’ and ‘cellular response to DNA damage’ were the highest enriched in both LPAIV and HPAIV infected lungs. In HPAIV and LPAIV infected lungs, 15 and 4 cellular component (CC) terms were significantly enriched, respectively (P<0.05, Fig. 2A and 2B, Supplementary Table S2). Most enriched terms in HPAIV and LPAIV infected lungs were ‘nucleus’ and ‘cytoplasm’ (P<0.05).

kjps-50-4-193-g2
Fig. 2. Barplot of the GO terms for the DEGs. (A) GO analysis of LPAI. (B) GO annotation classification of HPAI. GO classification of HPAI used top 10 term of each ontology.
Download Original Figure

Five molecular function (MF) terms were significantly enriched in HPAIV infected lungs, and the number of MF terms in LPAIV infected lungs was the same (P<0.05, Fig. 2A and 2B, Supplementary Table S2). The term 'poly (A) RNA binding' was the most enriched in HPAIV-infected lungs, whereas 'enzyme binding' was the most enriched in LPAIV-infected lungs. Furthermore, we functionally annotated common DEGs that were regulated in both HPAIV and LPAIV. As a result, we were able to obtain a total of 7 GO terms. Positive control of 'fibroblast apoptotic process’, ‘mitotic nuclear division’, and ‘mitotic chromosome condensation’ were enriched in BP terms, ‘cytoplasm and spindle microtubule’ were enriched in CC terms, and histone binding terms were enriched in MF terms (Table 3).

Table 3. Gene ontology (GO) analysis of common DEGs of which expression were altered by AIV infection in chicken lungs
GO Terms Count P-value
Biological process terms Positive regulation of fibroblast apoptotic process 2 2.8E-2
Mitotic nuclear division 3 1E-2
Mitotic chromosome condensation 2 5.0E-2
Cellular component terms Cytoplasm 17 6.2E-2
Spindle microtubule 2 9.4E-2
Molecular function terms Histone binding 3 5.8E-3
Download Excel Table
3. Expression Profile of Target Genes in Poly (I:C) Stimulated DF-1 Cells

RT-qPCR was performed to evaluate the expression of 16 common DEGs that have been found to be strongly altered by IAV infection in PIC-treated DF-1 cells (Fig. 3). Among 16 genes, we selected 5 genes, i.e., CDC-like kinase 3 (CLK3), Interferon Alpha Inducible Protein 6 (IFI6), Nucleic acid binding protein 1 (NABP1), PIN2/TERF1-interacting telomerase inhibitor 1 (PINX1), WNT1-inducible-signaling pathway protein 1 (WISP-1) for further study. CLK3, IFI6, NABP1, and PINX1 expressions were dramatically increased, but WISP-1 expression was significantly downregulated. In addition, the expression of CLK3, IFI6, NABP1, and PINX15, except WIPS1, increased with time and in a dose-dependent manner in the presence of PIC (Fig. 4).

kjps-50-4-193-g3
Fig. 3. Expression profile of common DEGs after PIC stimulation in DF-1 cells. Significant differences in expression levels between Poly I:C and control are indicated as follows: *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Error bars indicate standard error.
Download Original Figure
kjps-50-4-193-g4
Fig. 4. Time and dose dependent expression profile of selected target genes after PIC stimulation. Significant differences in expression levels between PIC and control are indicated as follows: *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Error bars indicate standard error.
Download Original Figure

DISCUSSION

Using a reanalysis of transcriptome data from a previous study, we investigated the molecular signatures for common responses in chicken lung cells to two AIV strains, LPAIV and HPAIV. Six microarray datasets obtained from prior work were used to perform comparative examinations of common and particular DEGs in HPAI H5N1 50-92 and LPAI H2N3 infected chicken lung cells (Kuchipudi et al., 2014). The similar method has previously been used to evaluate gene expression in a range of avian species and has proven to be an effective tool for gene expression profiling (Moody et al., 2002; Crowley et al., 2009; Kuchipudi et al., 2014; Won et al., 2016). Bioinformatics analysis revealed that MCM9 was shown to be the most positively regulated as a consequence of HPAIV infection in chickens. This gene is a member of the MCM gene family that is essential to form initiation complex for eukayotic genome replication (Lutzman et al., 2005) and has been connected to DNA mismatch repair (MMR) in the previous study (Traver et al., 2015). A prior study established a link between MCM complexes and latency-associated nuclear antigen (LANA), which is involved in viral genome replication and episome segregation (Dabral et al., 2019). However, in our analysis, this gene was never identified to be involved in any biological process or to perform any biochemical action, but was simply shown to be located in the nucleus. On the other hand, the most negatively regulated gene, HNRNPDL, which belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins, has been reported to control mRNA species for the expression of different proteins and to control IAV (Kawamura et al., 2002; Li et al., 2019; Van Cuong et al., 2019).

In LPAIV, the most positively regulated gene, INTS6, which is a putative RNA helicase, a member of DEAD box proteins, was reported to be involved in RNA metabolism including degradation (Rocak and Linder, 2004; Heung and Del Poeta, 2005). On the other hand, the most negatively regulated gene, SCN8A, belongs to the sodium channel alpha subunit gene family and is naturally involved in the establishment of sodium channels in the nervous system (O'Brien and Meisler, 2013; Wagnon et al., 2016).

Even while we were unable to identify the BP, MF, and CC to which MCM9, INTS6, and SCN8A may potentially contribute based on bioinformatics analysis, this does not rule out the possibility that these proteins play a role in AIV infection pathogenesis. Further study is needed to determine their roles in the pathophysiology of AIV infection in chickens.

We used DF-1 cells to perform expression analysis on the common DEGs that were reported to be affected by both HPAIV and LPAIV infected chicken lungs, in order to elucidate the involvement of TLR3 signals in transcriptional regulation of them. Among the selected common DEGs, CLK3 was known to be up regulated by virus infection (Alam et al., 2019). CLK3 was initially described as regulating pre-mRNA splicing (Menegay, 1999). In addition, CLK3 has also been demonstrated to activate growth factor-stimulated signal transduction cascade components, culminating in the activation of the mitogen-activated protein kinases cascades, i.e. ERK-1, ERK-2, and pp90RSK (Myers et al., 1994). NABP1 gene is known to regulate cellular DNA damage response including cell-cycle checkpoint activation, recombinational repair and maintenance of genomic stability (Richard et al., 2008). For PINX1 gene, it is known that PinX1 can directly interact with the telomerase catalytic component hTERT and inhibit telomerase activity and in some cancer cells, induces apoptosis and suppresses cell proliferation. These evidences suggest that PINX1 is an endogenous telomerase inhibitor and a potential tumor suppressor (Liu et al., 2013). IFI6, also known as G1P3, IFI-6-16 and IFI616 is a gene that belongs to the interferon stimulated genes (ISGs) (Chen et al., 2016). This gene was reported to be involved in various activities including regulation of apoptosis and is thought to possess anti-viral effects even though this is not yet well elucidated (Qi et al., 2015).

Collectively, the results presented indicate that candidate genes, which expressed both in LPAIV and HPAIV infection play important roles in innate immune response.

CONCLUSION

This study brings in new information about DEGs and their biological functions in the pathogenesis of HPAIV and LPAIV in chicken cells. We reported that many DEGs in HPAIV-infected chickens were involved in cell cycle, which may explain the severity and fatality of the disease. We also reported that IAV may have suppressed IFI6, a novel anti-viral gene, as a strategy to evade the host surveillance system. We finally reported that IFI 6 is expressed through TLR3 signaling pathway via NFκβ. Further studies should focus on elucidating the association between IAV and IFI6 to better understand the pathogenesis of these viruses, which would lead to the development of novel therapeutic strategies.

This study brings in new information about DEGs and their biological functions in the pathogenesis of HPAIV and LPAIV in chicken cells. We reported that some DEGs found to be involved in some key cellular functions like cell cycle might have facilitated HPAIV replication into the chicken cells. We also reported that they might be a possibility that HPAIV might have suppressed some important anti-viral genes in order to evade the host surveillance system. Further studies would focus to elucidate the mechanisms of these associations, which would lead to the development of novel therapeutic strategies.

SUMMARY

인플루엔자 A 바이러스(IAVs)는 많은 조류 종의 호흡 기관에 감염되며 사람을 비롯한 다른 동물로 전파될 수 있는 포장된 음극성 역전사 RNA 바이러스이다. 이 연구에서는 이전 연구의 마이크로어레이 데이터를 다시 분석하여 닭에서 공통 및 특이하게 발현되는 유전자(DEG) 및 그들의 생물학적 활동을 식별하였다. 고병원성(HPAIV) 및 저병원성(LPAIV) 인플루엔자 A 바이러스 감염된 닭 세포에서 각각 760개와 405개의 DEG가 발굴되다. HPAIV 및 LPAIV는 각각 670개와 315개의 DEG를 가지고 있으며, 이 중 90개의 DEG가 두 바이러스에서 공유된다. HPAIV 감염으로 인해 DEG의 기능 주석에 따르면 세포 주기의 기본적인 생물학적 기능과 연관된 다양한 유전자가 발굴되었다. 대상 유전자 중에서 CDC Like Kinase 3(CLK3), Nucleic Acid Binding Protein 1(NABP1), Interferon-Inducible Protein 6(IFI6), PIN2 (TERF1) Interacting Telomerase Inhibitor 1(PINX1), 그리고 Cellular Communication Network Factor 4(WISP1)의 발현은 polyinosinic:polycytidylic acid(PIC)로 처리된 DF-1 세포에서 변화되었다. 이것은 toll-like receptor 3(TLR3) 리간드인 TLR3 신호에 의해 이러한 유전자의 전사가 조절될 수 있음을 시사하며, 닭에서 AIV의 병리 생리학에 대한 더 나은 이해를 얻기 위해서는 AIV 감염 과정 중에 호스트 반응을 조절할 수 있는 메커니즘을 구명하는 데 더 많은 연구에 초점을 맞추는 것이 필요하다고 사료된다. 이러한 메커니즘에 대한 이해는 신규 치료 전략 개발에 활용될 수 있다.

ACKNOWLEDGMENTS

This work was supported by the “Cooperative Research Program for Agriculture Science and Technology Development” (Project No. PJ015612), Rural Development Administration, Republic of Korea and Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2021R1I1A3057071)”. The authors would like to thank Dr. Won, K.H. and Ryu, W.J. from Department of Animal Biotechnology of JBNU for the assistance in DEGs identification from microarray data and initial stage of qPCR validation, respectively.

Supplementary Materials

Supplementary Tables

kjps-50-4-193-suppl1.pdf

REFERENCES

1.

Evseev D, Magor KE 2019 Innate immune responses to avian influenza viruses in ducks and chickens Vet Sci 6(1):5.

2.

Alam MM, Sanchez-Azqueta A, Janha O, Flannery EL, Mahindra A, Mapesa K, et al. 2019 Validation of the protein kinase PfCLK3 as a multistage cross-species malarial drug target. Science 365:6456.

3.

Chen S, Li S, Chen L 2016 Interferon inducible Protein 6-16 (IFI 6 16, ISG16) promotes Hepatitis C virus replication in vitro. J Med Virol 88(1):109-114.

4.

Crowley TM, Haring VR, Burggraaf S, Moore RJ 2009 Application of chicken microarrays for gene expression analysis in other avian species In: BMC Genomics p S3.

5.

Dabral P, Uppal T, Rossetto CC, Verma SC 2019 Minichromosome maintenance proteins cooperate with LANA during the G1/S phase of the cell cycle to support viral DNA replication. J Virol 93(7):e02256-02218.

6.

Heung LJ, Del Poeta M 2005 Unlocking the DEAD-box: a key to cryptococcal virulence? J Clin Invest 115(3):593-595.

7.

Hogg JR 2016 Viral evasion and manipulation of host RNA quality control pathways. J Virol 90(16):7010-7018.

8.

Kawamura H, Tomozoe Y, Akagi T, Kamei D, Ochiai M, Yamada M 2002 Identification of the nucleocytoplasmic shuttling sequence of heterogeneous nuclear ribonucleoprotein D-like protein JKTBP and its interaction with mRNA. J Biol Chem 277(4):2732-2739.

9.

Kim Y-I, Park SJ, Kwon HI, Kim EH, Si YJ, Jeong JH, Lee IW, Nguyen HD, Kwon JJ, Choi WS 2017 Genetic and phylogenetic characterizations of a novel genotype of highly pathogenic avian influenza (HPAI) H5N8 viruses in 2016/2017 in South Korea. Infect Genet Evol 53:56-67.

10.

Kuchipudi SV, Tellabati M, Sebastian S, Londt BZ, Jansen C, Vervelde L, Brookes SM, Brown IH, Dunham SP, Chang KC 2014 Highly pathogenic avian influenza virus infection in chickens but not ducks is associated with elevated host immune and pro-inflammatory responses. Vet Res 45(1):118.

11.

Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402-428.

12.

Li RZ, Hou J, Wei Y, Luo X, Ye Y, Zhang Y 2019 hnRNPDL extensively regulates transcription and alternative splicing. Gene 687:125-134.

13.

Liu JY, Qian D, He LR, Li YH, Liao YJ, Mai SJ, Tian XP, Liu YH, Zhang JX, Kung HF, Zeng YX, Zhou FJ, Xie D 2013 PinX1 suppresses bladder urothelial carcinoma cell proliferation via the inhibition of telomerase activity and p16/cyclin D1 pathway. Mol Cancer 12(1):148.

14.

Lutzmann M, Maiorano D, Méchali M 2005 Identification of full genes and proteins of MCM9, a novel, vertebrate-specific member of the MCM2-8 protein family. Gene 362:51-56.

15.

May JP, Yuan X, Sawicki E, Simon AE 2018 RNA virus evasion of nonsense-mediated decay. PLoS Pathog 14(11): e1007459.

16.

Menegay H, Moeslein F, Landreth G 1999 The dual specificity protein kinase CLK3 is abundantly expressed in mature mouse spermatozoa. Exp Cell Res 2532:463-473.

17.

Moody D, Zou Z, McIntyre L 2002 Cross-species hybridisation of pig RNA to human nylon microarrays. BMC Genomics 31:27.

18.

Myers MP, Murphy MB, Landreth G 1994 The dual-specificity CLK kinase induces neuronal differentiation of PC12 cells. Mol Cell Biol 14:6954-6961.

19.

O'Brien JE, Meisler MH 2013 Sodium channel SCN8A (Nav1.6): properties and de novo mutations in epileptic encephalopathy and intellectual disability. Front Genet 4:213.

20.

OIE 2018 OIE situation report for highly pathogenic avian influenza. http://www.oie.int/fileadmin/Home/eng/Animal_ Health_in_the_World/docs/pdf/OIE_AI_situation_report/OIE_SituationReport_AI_Aug. Accessed on March 5, 2020.

21.

Organization, WH 2018 Cumulative Number of Confirmed Human Cases for Avian Influenza A (H5N1) reported to WHO, 2003−2018 Geneva: World Health Organization.

22.

Plague F, Aviaire G 2006 Avian Influenza.

23.

Pantin-Jackwood MJ, Swayne D 2009 Pathogenesis and pathobiology of avian influenza virus infection in birds.

24.

Qi H, Chu V, Wu NC, Chen Z, Truong S, Brar G, Su SY, Du Y, Arumugaswami V, Olson CA 2017 Systematic identification of anti-interferon function on hepatitis C virus genome reveals p7 as an immune evasion protein. Proc Natl Acad Sci 114(8):2018-2023.

25.

Qi Y, Li Y, Zhang Y, Zhang L, Wang Z, Zhang X, Gui L, Huang J 2015 IFI6 inhibits apoptosis via mitochondrial-dependent pathway in dengue virus 2 infected vascular endothelial cells. PLoS One 10(8).

26.

Ranaware PB, Mishra A, Vijayakumar P, Gandhale PN, Kumar H, Kulkarni DD, Raut AA 2016 Genome wide host gene expression analysis in chicken lungs infected with avian influenza viruses. PLoS One 11(4):e0153671.

27.

Richard DJ, Bolderson E, Cubeddu L, Wadsworth RI, Hay RT, Gautier J, West SC, Paull TT, Pandita TK, White MF, Khanna KK. 2008 Single-stranded DNA-binding protein hSSB1 is critical for genomic stability. Nature 4537195:677-681.

28.

Ritchie ME, Silver J, Oshlack A, Holmes M, Diyagama D, Holloway A, Smyth GK 2007 A comparison of background correction methods for two-colour microarrays. Bioinformatics 2320:2700-2707.

29.

Rocak S, Linder P 2004 DEAD-box proteins: the driving forces behind RNA metabolism. Nat Rev Mol Cell Biol 53:232-241.

30.

Smith J, Smith N, Yu L, Paton IR, Gutowska MW, Forrest HL, Danner AF, Seiler JP, Digard P, Webster RG 2015 A comparative analysis of host responses to avian influenza infection in ducks and chickens highlights a role for the interferon-induced transmembrane proteins in viral resistance. BMC Genomics 16:574.

31.

Swayne DE 2009 Avian Influenza John Wiley & Sons.

32.

Traver S, Coulombe P, Peiffer I, Hutchins JR, Kitzmann M, Latreille D, Méchali M 2015 MCM9 is required for mammalian DNA mismatch repair. Mol Cell 59:831-839.

33.

Van Cuong T, Cho SY, Kwon J, Kim D 2019 Elucidation of the Inhibitory mechanisms of Nipponoparmelia laevior lichen extract against influenza A (H1N1) virus through proteomic analyses. J Microbiol Biotechnol 29:1156-1165.

34.

Wagnon JL, Barker BS, Hounshell JA, Haaxma CA, Shealy A, Moss T, Parikh S, Messer RD, Patel MK, Meisler MH 2016 Pathogenic mechanism of recurrent mutations of SCN8A in epileptic encephalopathy. Ann Clin Transl Neurol 3(2):114-123.

35.

Wang S, Li H, Chen Y, Wei H, Gao GF, Liu H, Huang S, Chen JL 2012 Transport of influenza virus neuraminidase (NA) to host cell surface is regulated by ARHGAP21 and Cdc42 proteins. J Biol Chem 287(13):9804-9816.

36.

Won KH, Song KD, Park JE, Kim DK, Na CS 2016 Identification of gene expression signatures in the chicken intestinal intraepithelial lymphocytes in response to herb additive supplementations. Asian-Australas J Anim Sci 29(10):1515.

[공지] 한국가금학회 학술지 영문화 전환 및 논문 투고 안내


안녕하십니까, 한국가금학회 편집위원회입니다.

저희 한국가금학회는 학술지의 국제적 위상 제고와 연구 성과의 폭넓은 공유를 위해,
2025년 11월 정기총회에서 영문 학술지로의 전환을 결정한 바 있습니다.

앞으로 본 학술지는 모든 투고 논문을 영문으로 작성하여 접수받으며,
국제적인 심사 기준을 통해 고품질의 연구를 게재하고자 합니다.

새로운 도약을 위한 이번 변화에 회원 및 연구자 여러분의 적극적인 관심과 투고를 부탁드립니다.

 

1. 주요 변경 사항
 · 투고 언어: 전면 영문
 · 적용 시기: 2026년 5월 투고분부터

 

2. 학술지명 변경
 · 기존: 한국가금학회지, Korean Journal of Poultry Science
 · 변경: Poultry Science and Biotechnology

 

3. 논문 투고 및 심사 안내
 · 투고처: https://www.ekjps.org (온라인 논문 투고 시스템 링크 )
 · 투고 규정: 새로운 영문 템플릿 준수
 · 문의: 편집위원장

 

더욱 발전된 모습으로 학문 교류의 장이 될 수 있도록 최선을 다하겠습니다.

 

감사합니다.

 

(사)한국가금학회 회장 민원기 올림

(사)한국가금학회 편집위원장 허정민 올림


I don't want to open this window for a day.