Article

육계 사료 내 삼채(Allium hookeri) 첨가에 따른 사양성적 및 장 건강 지표 변화

이채원1https://orcid.org/0000-0002-8281-5478, 윤준혁1https://orcid.org/0000-0002-1862-1281, 안수현2,3https://orcid.org/0000-0001-6236-6815, 조인호1https://orcid.org/0000-0003-2367-5468, 공창수4,5,6,https://orcid.org/0000-0002-3876-6488
Chae Won Lee1https://orcid.org/0000-0002-8281-5478, June Hyeok Yoon1https://orcid.org/0000-0002-1862-1281, Su Hyun An2,3https://orcid.org/0000-0001-6236-6815, In Ho Cho1https://orcid.org/0000-0003-2367-5468, Changsu Kong4,5,6,https://orcid.org/0000-0002-3876-6488
Author Information & Copyright
1경북대학교 축산BT학과 대학원생
2경북대학교 축산BT학과 박사후연구원
3경북대학교 말산업연구원 박사후연구원
4경북대학교 축산학과 교수
5경북대학교 축산BT학과 교수
6경북대학교 말산업연구원 교수
1Graduate Student, Department of Animal Science and Biotechnology, Kyungpook National University, Sangju 37224, Republic of Korea
2Post-Doctoral Researcher, Department of Animal Science and Biotechnology, Kyungpook National University, Sangju 37224, Republic of Korea
3Post-Doctoral Researcher, Research Institute of Horse Industry, Kyungpook National University, Sangju 37224, Republic of Korea
4Professor, Department of Animal Science, Kyungpook National University, Sangju 37224, Republic of Korea
5Professor, Department of Animal Science and Biotechnology, Kyungpook National University, Sangju 37224, Republic of Korea
6Professor, Research Institute of Horse Industry, Kyungpook National University, Sangju 37224, Republic of Korea
To whom correspondence should be addressed : changsukong@knu.ac.kr

© Copyright 2023, Korean Society of Poultry Science. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Aug 20, 2023; Revised: Sep 06, 2023; Accepted: Sep 10, 2023

Published Online: Sep 30, 2023

적 요

본 연구는 28일령 육계 사료 내 삼채(Allium hookeri) 뿌리를 첨가했을 시 사양성적, 혈청 항산화 효소 활성, 맹장 내 지방산 조성 및 밀착연접(tight junction) 단백질 관련 유전자 발현에 미치는 영향을 알아보기 위하여 수행되었다. 부화 직후 동일한 사양조건과 사료 급여 조건에서 사육한 10일령 수평아리 96수를 공시하여 2처리, 6반복, 반복당 8수로 실험구를 배치하였다. 옥수수-대두박을 기초로 하는 사료를 급이한 대조구와 옥수수-대두박 기초사료에 삼채를 0.3% 첨가한 실험사료를 급이한 처리구로 구성되었다. 28일령에 각 케이지의 중앙값에 해당하는 체중을 지닌 개체를 선별하여 혈액, 맹장 소화물, 공장 조직을 채취하였다. 증체량과 사료섭취량에는 차이가 없었으나 삼채 뿌리를 첨가한 사료를 섭취한 처리구에서 21일령까지 그리고 전체 실험기간 중의 사료효율이 유의하게 높은 결과를 관찰하였다(P<0.05). 삼채 뿌리가 혈청 항산화 효소 활성, 맹장 내 지방산 조성, 밀착연접 단백질 관련 유전자 발현에 미치는 영향은 나타나지 않았다. 결론적으로 육계 사료 내 삼채 뿌리의 첨가는 28일령 육계의 사료효율을 제외한 사양 성적 및 생리적 지표에 영향을 미치지 않았다.

ABSTRACT

The present study aimed to investigate the effect of Allium hookeri (AH) root on growth performance, serum antioxidant enzyme activity, cecal short-chain fatty acid profiles, and tight junction-related gene expression of broiler chickens. On day 10, 96 birds were allocated to one of two dietary treatments with 6 replicate cages, and 8 birds per cage in a randomized complete block design. The experimental diets consisted of a corn-soybean meal-based control diet and a diet supplemented with 0.3% AH root powder at the expense of the corn in the control diet. The experimental diets were formulated to meet or exceed the nutrients requirements of broilers recommended by Aviagen for each phase (from day 10 to 21 and from day 21 to 28). On day 28, a bird representing the median body weight in each cage was selected, and then blood, cecal digesta, and jejunum tissue samples were collected. No significant differences were observed in body weight gain and feed intake among dietary treatments. However, birds fed the diet containing AH showed a greater gain-to-feed ratio compared to the control group at 21 days of age and throughout the entire experimental period (P<0.05). Serum antioxidant enzyme activity, cecal short-chain fatty acid profiles, and tight junction-related gene expression were not affected by the dietary AH supplementation. Based on the results of the present study, dietary AH supplementation may improve the gain-to-feed ratio, but not gut health markers in broiler chickens from day 10 to 28.

Keywords: 삼채 뿌리; 육계; 장 건강; 사양성적
Keywords: Allium hookeri; broiler; growth performance; gut health

서 론

세계적으로 닭고기 소비량은 돼지고기나 소고기를 포함하는 다른 단백질 공급원보다 크게 증가하고 있으며, 가금육의 생산량은 앞으로 더욱 증가할 것으로 예측되고 있다(Greenhalgh et al., 2020). 국내 일인당 닭고기 소비량 또한 지속적으로 증가함과 동시에 닭고기 수입량도 함께 증가하고 있다(Park et al., 2022). 국내 닭고기 자급률은 다른 나라에 비해 상대적으로 낮으며, 이를 충족하기 위해 가금산업 생산력의 개선이 필요하다(Park et al., 2021; 2022).

가금 산업에서 항생제는 동물의 성장촉진과 질병 예방 및 치료의 목적으로 사용되어졌다(Jammoul and Darra, 2019; Qiu et al., 2021). 그러나 2006년 EU에서는 동물 사료 내 항생제 사용을 전면 금지하였으며(Casewell et al., 2003), 이후 국내에서도 2011년부터 동물 사료 내 첨가를 규제하고 있다(Lee et al., 2014a). 항생제 사용에 대한 대안으로 항생제를 대체할 후보 물질 개발을 위해 현재까지 식물추출물, 미세조류, 유산균, 곤충을 포함하는 첨가제 활용에 대한 연구가 수행되고 있다(Wu et al., 2019; An et al., 2020; Kim et al., 2020; Jo et al., 2021).

삼채(Allium hookeri)는 체외실험 및 마우스 실험을 통해 항산화, 항염증, 항당뇨, 항비만, 및 항염증 효과가 있다고 알려져 있다(Kim et al., 2019a; Choi et al., 2021). 또한, 육계 사료 내에서 염증성 사이토카인의 발생을 감소시키고 밀착연접(tight junction) 단백질 발생을 향상시킬 수 있다고 보고되었다(Lee et al., 2017). 특히 페놀화합물과 플라보노이드가 풍부하고, 부추속(Allium) 중에서도 유황화합물(organosulfur compounds)을 다량 함유하고 있다(Jeong et al., 2022). 페놀화합물과 플라보노이드는 활성산소의 반응을 억제하여 항산화 작용효과가 있다고 보고되었다(Aryal et al., 2019; Rho et al., 2020). 식물에서 유래한 페놀 성분 및 플라보노이드의 항산화능에 대한 연구가 많이 진행되고 있으며(Aryal et al., 2019; Phuyal et al., 2020), Seomoon and Jang(2022)은 가금 사료 내 천연 항산화제로서 식물성 플라보노이드의 활용 가능성에 대해 보고했다. 유황화합물 또한 항산화작용에 영향을 주는 것으로 알려져 있으며, 삼채 뿌리 추출물의 항염증 및 항산화 효과를 확인하는 체외실험 연구가 수행되었다(Zhang et al., 2015; Jang et al., 2017). 알리신(Allicin)과 같은 황함유 화합물(C6H10OS2)은 장내 미생물 조성에 긍정적인 영향을 미치며(Panyod et al., 2020), 돼지 사료 내에서 α-ketoglutarate와 함께 급이했을 때 장내 미생물과 휘발성 지방산 조성을 변화시킨다는 연구결과가 보고되었다(Liu et al., 2018). Viveros et al.(2011)은 육계 사료 내 폴리페놀이 장내 미생물 조성에 영향을 미칠 수 있다고 보고하였다. Lee et al.(2018a)은 삼채 급여가 육계의 성장 및 경골강도 강화에 효과가 있다고 보고하였으나, 자세한 작용 기전에 대해서는 추가적인 연구가 필요하다.

장 건강은 육계 산업에서 질병 예방 및 사양성적 향상을 위해 중요하게 여겨지는 요인이다(Zhu et al., 2021). 잎(leaf), 인경(bulb), 뿌리(root)로 구분되는 삼채는 부위별로 총페놀 함량, 총플라보노이드 함량이 다르다고 보고되며(Hwang et al., 2015), 삼채의 부위별 다양한 생리적 효능에 대한 연구가 활발히 진행 중이다(Lee et al., 2018a; 2020; Jeong et al., 2022). 하지만 현재까지 사료 내 삼채 뿌리 첨가가 육계의 장 건강 지표에 미치는 효능에 대한 연구는 제한적이다. 따라서 본 실험은 사료 내 삼채 추출물의 첨가가 육계의 사양성적 및 항산화효소 활성의 변화, 휘발성 지방산의 조성, 및 밀착연접 단백질 관련 유전자 발현에 미치는 영향을 확인하기 위하여 수행되었다.

재료 및 방법

본 연구의 동물실험은 경북대학교 동물실험윤리위원회 규정에 따라 진행되었다(승인번호: KNU2022-0202).

1. 동물, 사료, 실험설계 및 사양성적

초생추 수컷 육계(Ross 308) 96수에 개별 인식표를 부착 후 시판 초이 사료(대사에너지, 2,998.8 kcal/kg; 조단백질, 21.82%)를 10일간 급이하였다. 10일차에 개별체중을 측정하였고, 구배치는 개시체중을 기준으로 2처리 6반복, 케이지 당 8수씩 배치되도록 난괴법을 이용하였다. 실험에 사용된 사료는 옥수수-대두박 위주의 대조사료와 대조사료에 옥수수를 대체하여 분말 형태의 삼채 추출물을 0.3% 첨가한 배합사료로 구성되었다(Table 1). 사료 내 모든 영양소 함량은 Aviagen(2019)에 제시된 요구량 이상이 첨가되도록 배합하였으며 이에 대한 정보는 Table 2에 제시하였다.

Table 1. Ingredients composition of experimental diets (as-fed basis, %)
Item Starter (day 10 to 21) Grower (day 21 to 28)
Control Allium hookeri Control Allium hookeri
Ingredient
Corn 54.25 53.95 61.24 60.94
Soybean meal 37.58 37.58 31.05 31.05
Allium hookeri root - 0.30 - 0.30
Soybean oil 3.00 3.00 3.00 3.00
L-Ile (99%) 0.05 0.05 0.02 0.02
L-Lys-HCl (79%) 0.15 0.15 0.11 0.11
L-Met (99%) 0.21 0.21 0.18 0.18
L-Cys (99%) 0.14 0.14 0.10 0.10
L-Thr (98.5%) 0.12 0.12 0.09 0.09
L-Val (98%) 0.08 0.08 0.06 0.06
Limestone 1.22 1.22 1.10 1.10
Monocalcium phosphate 1.60 1.60 1.45 1.45
Salt 0.40 0.40 0.40 0.40
Vitamin premix1 0.50 0.50 0.50 0.50
Mineral premix2 0.50 0.50 0.50 0.50
Choline chloride 0.20 0.20 0.20 0.20
Total 100.00 100.00 100.00 100.00

1 Supplies the following per kilogram of diet: vitamin A, 24,000 IU; vitamin D3, 8,000 IU; vitamin E, 160 mg; vitamin K3, 8 mg; vitamin B1, 8 mg; vitamin B2, 20 mg; vitamin B6, 12 mg; pantothenic acid, 40 mg; folic acid, 4 mg; niacin, 12 mg.

2 Supplies the following per kilogram of diet: Fe, 120 mg; Cu, 320 mg; Zn, 200 mg; Mn, 240 mg; Co, 2 mg; Se, 0.6 mg; I, 2.5 mg.

Download Excel Table
Table 2. Calculated energy and nutrient compositions of the experimental diets (as-fed basis, %)
Item Starter (day 10 to 21) Grower (day 21 to 28)
Control Allium hookeri Control Allium hookeri
MEn1 (kcal/kg) 2,900 2,889 2,989 2,979
Crude protein 21.50 21.47 19.00 18.98
Calcium 0.87 0.87 0.78 0.78
Non-phytate phosphorus 0.44 0.44 0.39 0.39
SID2 amino acids
Arg 1.24 1.24 1.17 1.17
His 0.47 0.47 0.44 0.44
Ile 0.77 0.77 0.72 0.72
Leu 1.49 1.49 1.45 1.44
Lys 1.15 1.15 1.04 1.04
Met 0.46 0.46 0.44 0.44
Cys 0.37 0.37 0.34 0.34
Phe 0.90 0.90 0.84 0.84
Thr 0.77 0.77 0.73 0.73
Trp 0.24 0.24 0.19 0.19
Val 0.89 0.88 0.83 0.83

1 MEn, nitrogen-corrected metabolizable energy.

2 SID, standardized ileal digestible.

Download Excel Table

육계는 전 실험기간 동안 배터리 케이지(50 × 60 × 60cm)에서 사양되었고, 물과 사료는 무제한 급이하였다. 실험사료 급이에 따른 증체량 계산을 위해 21과 28일령째에 전기 및 후기 육계의 개별체중을 측정하였다. 후기사료 교체(21일령) 및 실험 종료일(28일령)에 사료 잔량을 기록하여 실험사료 섭취량을 계산하였다.

2. 항산화지표 분석

실험 종료일인 28일차에 각 반복별로 평균 체중에 해당하는 1수를 선발하여 경정맥에서 채혈을 하고 진공채혈관(BD Biosciences, Franklin Lakes, NJ, USA)에 담았다. 채취한 전혈은 3,000 rpm, 4°C로 15분간 원심분리를 진행하여 혈청을 분리한 후 분석전까지 −20°C에서 보관하였다. 혈청 내 malondialdehyde(MDA)는 OxiSelect TBARS Assay kit(Cell Biolabs, Inc., San Diego, CA)를 이용하여 측정하였다. Catalase(CAT)는 OxiSelect™ Catalase Assay kit(Cell Biolabs, Inc., San Diego, CA)를 이용하여 측정하였고, NO는 QuantiChrom Nitric Oxide Assay kit(BioAssay Systems, Inc., Hayward, CA)를 이용하여 측정하였다. Superoxide dismutase(SOD)는 EnzyChrom Superoxide Dismutase Assay kit(BioAssay Systems, Inc., Hayward, CA)를 이용하여 측정하였다. Glutathione Peroxidase(GPx)는 EnzyChrom Glutathione Peroxidase Assay kit(EGPX-100) (BioAssay Systems, Inc., Hayward, CA)를 이용하여 측정하였으며, 모든 측정 방법은 제조사가 제시하는 방법에 따라 실시하였다.

3. 휘발성 지방산 분석

맹장 소화물에서 휘발성 지방산 조성을 분석하기 위하여 각 반복별로 평균 체중에 해당하는 1수를 선발하여 이산화탄소로 안락사시킨 후 맹장 소화물 1 g을 채취하였다. 채취한 시료에 미생물 작용을 정지하기 위하여 HgCl2, 25% H3PO4 용액 및 Pivalic acid 용액을 첨가한 후 vortexing 하여 시약과 샘플을 혼합하였다. 그 후 3,000 rpm에 20분동안 원심분리 후 상층액 1 mL를 취하여 분석 전까지 냉동 보관하였다. 휘발성 지방산 조성은 gas chromatography(6,890 Series GC System; HP, Palo Alto, CA, USA)를 이용하여 분석하였고, 분석에 사용된 column은 capillary column(30 m × 0.25 mm × 0.25 γm; Agilent, Santa Clara, CA, USA)을 이용하였다. Injector 온도는 180°C였으며 detector 온도는 250°C로 유지하였고, 헬륨 가스를 이동상으로 이용하였다.

4. 밀착연접 단백질 관련 유전자 발현 분석

RNA의 추출을 위해 TRI-Solution™(Bio Science Technology, Daegu, Korea)을 제조사의 프로토콜에 따라 사용하였다. 추출된 RNA는 Epoch Microplate Spectrophotometer(BioTek Instruments Inc, USA)를 이용하여 농도를 측정하고 희석하였고, First Strand cDNA Synthesis Kit(Takara Bio Inc., Tokyo, Japan) 사용하여 cDNA를 합성하여 RT-PCR을 수행하였다. 본 실험에 사용된 프라이머는 NCBI database를 바탕으로 제작하였으며, 프라이머와 염기서열에 대한 정보는 Table 3에 나타내었다. Occludin, zonula occludens 1(ZO-1), junctional adhesion molecule 2(JAM2), 및 claudin 1 유전자의 발현량을 측정하기 위하여 commercial SYBR-Green PCR kit(Takara Bio Inc.)를 사용했다. 반응조건은 95°C 10분, 95°C 15초로 총 40 cycles을 진행하였고, melting curve 분석은 55°C에서부터 95°C까지 상승시켰다. qPCR 수행 후 각 유전자의 발현량은 GAPDH 발현량을 기준으로 상대적 정량을 하였으며, 상대적인 유전자 발현량은 22−ΔΔCt method(Livak and Schmittgen, 2001) 방법을 이용하였다.

Table 3. Quantitative real-time PCR primer sequences used in the present study
Target gene Primer sequence (5’ to 3’) Tm, °C
GAPDH F1: ACTTTGGCATTGTGGAGGGT 50.0
R2: GGACGCTGGGATGATGTTCT 55.0
Occludin F: TGGCCTTCGTCATGCTCAT 52.6
R: GCTGCACATGGCCAACAAG 57.9
JAM2 F: TGCTCCATGAAGCGAATGC 52.6
R: TGCCATTACCAGAGCCACAA 50.0
ZO-1 F: TATGAAGATCGTGCGCCTCC 55.0
R: TGCCGGATAATAGCTGCGTT 50.0
Claudin-1 F: GTGTTTGTTGCTGTGACGGG 55.0
R: GCCACTCTGTTGCCATACCA 55.0

1 F, forward.

2 R, reverse.

Download Excel Table
5. 통계분석

삼채 추출물 첨가에 따른 변화에 대한 결과의 통계 분석은 SAS의 MIXED procedure을 이용하여 실시하였다. 실험단위는 케이지로 하였으며, 통계 분석 시 고정효과는 실험 처리구였고, 체중에 따른 반복은 임의효과로 설정하였다. 모든 통계분석의 유의성은 0.05<P<0.1일 경우 경향이 있다고 판단하고, P<0.05일 경우 유의하다고 판단하였다.

결과 및 고찰

1. 삼채 뿌리 급이에 따른 육계의 사양성적 변화

Lee et al.(2018a)은 육계 사료 내 삼채 뿌리 0.3% 및 0.5%를 첨가하였을 때 육계의 증체량이 증가하였고, Lee et al.(2017)은 lipopolysaccharide(LPS)를 접종한 육계 사료 내 발효 삼채 뿌리 1%를 첨가했을 때 육계의 증체량이 증가했다고 보고하였다. 따라서, 본 연구에서는 최소 첨가 수준인 0.3%에서 사양성적이 향상되었던 선행 연구를 바탕으로 삼채 0.3% 첨가 수준이 기호성에 영향을 미치지 않으며 사양성적 및 장건강지표를 조사할 수 있는 사료 내 첨가수준이라고 판단하고 실험사료를 배합하여 실험을 수행하였다.

본 연구에서 사료 내 삼채 첨가 급여가 사양성적에 미치는 영향에 대한 결과를 Table 4에 나타내었다. 21일령, 28일령 및 사료 전 급이기간 동안 육계의 체중, 증체량 및 사료섭취량은 사료 내 삼채 뿌리 첨가에 영향을 받지 않았다. 사료효율의 경우, 전기(10~21일령) 및 사료 전 급이 기간에서 삼채 뿌리를 첨가한 사료를 섭취한 개체가 대조사료를 급이 한 개체보다 증가하는 것으로 나타났으며(P<0.05), 후기에서 증체량은 유의한 차이를 보이지 않았으나 증가하는 경향성을 보였다(P=0.061). 이와 유사한 연구로 Lee et al.(2018b)은 대조사료와 삼채 뿌리 1% 및 5% 첨가된 사료를 급이 한 육계의 체중을 비교하였을 때 14일령에서 삼채 뿌리 1% 첨가된 사료를 섭취한 육계의 체중은 증가한 반면, 21일령에서는 처리구간 체중의 차이가 나타나지 않았다는 결과를 보고하였다. 한편, Lee et al.(2018a)은 삼채 잎과 뿌리를 각각 0.3% 및 0.5% 첨가 급이하였을 때 5주령 육계 모든 처리구에서 체중이 증가하는 결과를 나타냈으며, 삼채 잎을 첨가한 처리구에서 삼채 뿌리를 첨가 급이한 처리구보다 체중이 유의하게 증가하였다. Lee et al.(2017)은 LPS를 접종한 육계에 삼채 뿌리 및 발효 삼채 뿌리를 각 1% 및 5% 첨가하여 사양성적을 비교한 연구에서 발효 삼채 뿌리 1% 첨가가 LPS를 접종한 육계의 사양성적을 개선함을 보여주었다. Lee et al.(2020)의 35일령 육계를 사용한 실험에서는 삼채 잎을 0.3% 및 0.5% 첨가한 사료를 급이한 육계가 대조사료를 급이한 육계보다 체중이 유의하게 증가하였으며, 이 결과는 장내미생물 조성과 관련이 있을 것이라고 보고하였다. 따라서 육계 사료 내 삼채 분말 0.3% 첨가에 따라 사료효율이 개선된 본 실험의 결과는 이전의 연구 결과와 부분적으로 일치하는 것으로 판단되었다.

Table 4. Growth performance of birds fed experimental diets from 10 to 21 days and from 21 to 28 days1
Item Experimental diets SEM2 P-value
Control Allium hookeri
Body weight (g)
day 10 235 235 10.9 0.679
day 21 684 720 24.8 0.190
day 28 1,100 1,149 31.7 0.138
Body weight gain (g/bird)
day 21 449 485 17.4 0.194
day 28 416 429 13.6 0.061
Overall 865 914 25.2 0.141
Feed intake (g/bird)
day 21 707 734 17.9 0.304
day 28 635 655 17.4 0.158
Overall 1,342 1,389 29.5 0.270
Gain-to-feed ratio (g:g)
day 21 0.63b 0.66a 0.011 0.036
day 28 0.66 0.66 0.008 0.929
Overall 0.64b 0.66a 0.006 0.015

1 Each value represents mean of 6 replicates.

2 SEM, standard error of the mean.

a,b Values with different superscripts within a column differ significantly (P<0.05).

Download Excel Table
2. 삼채 뿌리 급이에 따른 육계 혈청 내 항산화지표 변화

혈청 내 항산화지표(SOD, CAT, GPx, MDA 및 NO) 활성에 대한 삼채 뿌리의 효과를 알아보았으나, 대조 사료와 삼채 뿌리를 첨가한 사료 간에 유의적인 차이는 나타나지 않았다(Table 5). 삼채에 풍부한 폴리페놀 화합물(polyphenolic compounds)은 항산화 기능을 함으로써 산화 스트레스로부터 발생하는 질병을 예방하는 기능이 있는 것으로 알려져 있다(Manach et al., 2004; Hwang et al., 2015; Kothari et al., 2019). Jeong et al.(2022)은 마우스를 모델로 하여 삼채의 잎과 뿌리에서 항산화 효능을 측정하는 체외실험을 수행하였으며, 삼채 뿌리의 첨가는 CAT 효소 활성을 증가시킬 수 있다고 하였고, CAT의 생성은 삼채 뿌리 첨가 수준에 따라 다르게 나타났다. 또한 삼채의 잎과 뿌리에서 염증반응지표 물질인 NO의 생성을 증가하는 결과를 나타내어 면역반응을 촉진할 수 있다는 결과를 나타내었으나, Jang et al.(2017)의 연구에서는 삼채 뿌리 추출물이 NO 생성 및 활성산소 생성을 억제한다는 반대의 결과를 나타내었다. Hwang et al.(2015)은 삼채에 메탄올-물 혼합용매 추출물을 이용했을 때 물 또는 무수 메탄올 추출물보다 더 높은 총페놀 및 총플라보노이드 함량을 나타냈으며 총페놀 함량이 높을수록 항산화능이 증가한다는 상관관계를 보고하였다. 또한, Kim et al.(2019b)은 삼채 뿌리 에탄올 용매 추출물을 이용한 연구에서 총페놀 함량 및 총플라보노이드 함량, 황함량과 NO 생성량은 음의 상관관계를 나타낸다고 보고하였다. 사료 내 삼채의 총 페놀량은 사용 부위에 따라 다르며 주로 뿌리보다 잎에 다량 함유되어 항산화 활성은 상대적으로 잎에서 강하게 나타난다(Lee et al., 2014b; Hwang et al., 2015; Lee, 2016). 육계에서 삼채 추출물이 항산화 지표에 미치는 영향에 대해서는 더 연구가 필요한 것으로 보이지만, Lee et al.(2018b)의 연구에 따르면 삼채 뿌리 1%를 첨가했을 때 육계 혈청 내 SOD 및 CAT 수준이 증가하였다. 본 연구에서는 사료 내 삼채 뿌리 첨가가 NO 생성억제 및 항산화 활성 발현을 촉진할 것으로 기대하였으나, 그러한 결과가 나타나지 않았으며 그 이유는 사료 내 첨가된 삼채 뿌리의 총페놀 함량이 육계 체내에서 항산화 활성에 영향을 미치기에는 충분하지 못한 양이었을 것이라고 사료된다.

Table 5. Antioxidant activity in serum of birds fed experimental diets at day 281
Item Experimental diets SEM2 P-value
Control Allium hookeri
Superoxide dismutase (U/mL) 11.797 11.879 1.2025 0.9626
Catalase (U/mL) 9.554 8.538 0.5254 0.2016
Glutathione peroxidase (U/L) 29.991 31.631 1.1156 0.3232
Malondialdehyde (μmol/L) 12.208 12.845 1.5495 0.5587
Nitric oxide (μmol/L) 60.355 36.798 13.2293 0.3256

1 Each value represents mean of 6 replicates.

2 SEM, standard error of the mean.

Download Excel Table
3. 삼채 뿌리 급이에 따른 육계 맹장 소화물의 휘발성 지방산 변화

Branched-chain fatty acids(BCFA) 농도는 맹장 내용물 내 혈액의 존재 또는 병원성 미생물의 성장을 나타내는 지표로서 사용할 수 있다(Śliżewska et al., 2020). Short-chain fatty acids(SCFA)는 장내 상피세포의 에너지원이자 세포 성장을 촉진하며, 점막 면역 시스템을 조절하는 기능에 관여하는 기능을 한다(Faber et al., 2012; Schulthess et al., 2019). 휘발성 지방산 조성을 확인하기 위해 육계 맹장 소화물 내 acetate, 및 propionate, isobutyrate, butyrate, isovalerate, valerate, lactate, BCFA 및 SCFA 조성을 측정한 결과, 대조 사료와 삼채 뿌리 첨가 사료 간에 유의한 차이는 없었다(Table 6). 삼채에 다량 함유되어 있는 유기황 화합물은 유익균의 수를 늘림으로써 장내 미생물 구성을 바꿀 수 있다고 보고되었기 때문에, 지방산을 생성하는 미생물 종의 수를 변화시킬 가능성이 있을 것으로 사료된다(Guillamón et al., 2021; Liao et al., 2020; Portincasa et al., 2022). 육계 사료 내에서도 삼채의 첨가가 장내 미생물 조성을 변화시켰다는 선행연구가 존재한다(Lee et al., 2020). 따라서 삼채 첨가가 지방산 조성에 미치는 영향을 확인하기 위해서는 장내 미생물 종의 변화를 측정하여 특정 미생물의 증가 및 감소와 지방산 조성 변화를 비교하는 동물실험을 추가적으로 진행할 필요가 있는 것으로 보인다.

Table 6. Fatty acid composition (mM/g) in cecum digesta of birds fed experimental diets at day 281
Item Experimental diets SEM2 P-value
Control Allium hookeri
Acetate 0.620 0.780 0.0815 0.1558
Propionate 0.064 0.076 0.0068 0.2483
Isobutyrate 0.013 0.014 0.0015 0.7231
Butyrate 0.111 0.168 0.0357 0.2890
Isovalerate 0.011 0.010 0.0011 0.7139
Valerate 0.011 0.010 0.0012 0.9583
Lactate 0.279 0.286 0.0421 0.9058
Branched-chain fatty acids3 0.024 0.024 0.0014 0.9383
Short-chain fatty acids4 1.108 1.344 0.1157 0.1498

1 Each value represents mean of 6 replicates per treatment.

2 SEM, standard error of the mean.

3 Branched-chain fatty acids included isobutyrate; isovalerate.

4 Short-chain fatty acids included acetate; propionate; isobutyrate; butyrate; isovalerate; valerate; lactate.

Download Excel Table
4. 삼채 뿌리 급이에 따른 육계의 밀착연접 단백질 관련 유전자 발현

표피의 장벽 기능은 외부 물질 및 미생물과 내부 수분손실을 방지하는 역할을 수행하고, 이러한 피부장벽의 형성 및 기능은 부착이음(junction adhesion)과 밀착연접이 수행한다(Nguyen and Soulika, 2019). 본 실험에서는 28일령 육계 공장 조직에서 장 밀착연접의 주요 단백성분으로 occludin, ZO-1, JAM2 및 claudin 1의 유전자발현을 측정하였다. 모든 유전자 발현에서 유의한 차이는 나타나지 않았다(Table 7). Lee et al.(2017)은 LPS를 접종한 육계에서 JAM2, ZO-1 및 intestinal mucin 2의 발현이 감소했으나 발효 삼채 뿌리 1%를 첨가했을 때 향상되는 결과를 나타냈다. Lee et al.(2018c)의 육계를 이용한 연구에서 삼채 뿌리 1%를 사료에 첨가했을 때 대조구에 비해 밀착연접 단백질의 발현이 높았다. 그리고 necrotic enteritis(NE) challenge를 진행했을 때 밀착연접 단백질 발현이 감소하였으나, NE challenge를 진행한 상태에서 삼채 추출물을 1% 급이했을 시 ZO-1 및 occludin 유전자의 발현이 증가하는 모습을 보였다고 보고했다. 따라서 challenge 조건에 따라 삼채 추출물이 밀착연접 단백질 발현에 미치는 영향이 달라질 수 있다고 사료되며, 이를 고려한 후속 연구가 필요한 것으로 생각된다.

Table 7. The relative mRNA expression of occludin, zonula occludens 1 (ZO-1), junctional adhesion molecule 2 (JAM-2), and claudin-1 in jejunum tissue of birds fed experimental diets at day 281
Item Experimental diets SEM2 P-value
Control Allium hookeri
Occludin 1.0000 1.024 0.1713 0.9231
ZO-1 1.0000 1.262 0.2286 0.4369
JAM2 1.0000 0.976 0.1804 0.9156
Claudin 1 1.0000 1.172 0.2064 0.5686

1 Each value represents mean of 6 replicates.

2 SEM, standard error of the mean.

Download Excel Table

사 사

본 연구는 농촌진흥청의 연구사업(과제번호: RS-2021-RD010035)의 지원에 의해 이루어진 것임.

REFERENCES

1.

An SH, Joo SS, Lee HG, Kim ZH, Lee CS, Kim M, Kong C 2020 Supplementation of indigenous green microalga (Parachlorella sp.) to pre-starter diet for broiler chickens. Korean J Poult Sci 47(1):49-59.

2.

Aryal S, Baniya MK, Danekhu K, Kunwar P, Gurung R, Koirala K 2019 Total phenolic content, flavonoid content and antioxidant potential of wild vegetables from western Nepal. Plants 8(4):96.

3.

Aviagen 2019 Ross 308 performance objectives. https://en.aviagen.com/assets/Tech_Center/Ross_Broiler/Ross308-308FF-BroilerPO2019-EN.pdf. Accessed on January 12, 2022.

4.

Casewell M, Friis C, Marco E, McMullin P, Phillips I 2003 The European ban on growth-promoting antibiotics and emerging consequences for human and animal health. J Antimicrob Chemother 52(2):159–161.

5.

Choi JH, Lee EB, Jang HH, Cha YS, Park YS, Lee SH 2021 Allium hookeri extracts improve scopolamine-induced cognitive impairment via activation of the cholinergic system and anti-neuroinflammation in mice. Nutrients 13(8):2890.

6.

Faber TA, Dilger RN, Hopkins AC, Price NP, Fahey Jr GC 2012 Effects of oligosaccharides in a soybean meal-based diet on fermentative and immune responses in broiler chicks challenged with Eimeria acervulina1. Poult Sci 91(12):3132-3140.

7.

Greenhalgh S, Chrystal PV, Selle PH, Liu SY 2020 Reduced-crude protein diets in chicken-meat production: justification for an imperative. World's Poult Sci J 76(3):537-548.

8.

Guillamón E, Martínez PA, Salud NM, Fonollá J, Baños A 2021 Beneficial effects of organosulfur compounds from Allium cepaon gut health: A systematic review. Foods 10(8):1680.

9.

Hwang JS, Lee BH, An X, Jeong HR, Kim YE, Lee I, Lee H, Kim DO 2015 Total phenolics, total flavonoids, and antioxidant capacity in the leaves, bulbs, and roots of Allium hookeri. Korean J Food Sci Technol 47(2):261-266.

10.

Jammoul A, Darra NE 2019 Evaluation of antibiotics residues in chicken meat samples in Lebanon. Antibiotics 8(2):69.

11.

Jang JY, Lee MJ, You BR, Jin JS, Lee SH, Yun YR, Kim HJ 2017 Allium hookeri root extract exerts anti-inflammatory effects by nuclear factor-κB down-regulation in lipopolysaccharide-induced RAW264.7 cells BMC Complementary and Alternative. Medicine 17:126.

12.

Jeong UY, Jung J, Lee EB, Choi JH, Kim JS, Jang HH, Park SY, Lee SH 2022 Antioxidant and immune stimulating effects of Allium hookeri extracts in the RAW 264.7 cells and immune-depressed C57BL/6 mice. Antibiotics 11(10): 1927.

13.

Jo HS, Park ME, Hong SM 2021 Effect of dietary supplementation of fermented mealworm on the growth of juvenile stone flounder (Kareius bicoloratus). J Korea Acad Ind Coop Soc 22(4):312-320.

14.

Kim DW, Nho WG, Kim SH 2020 Efficacy of dietary supplementation of turmeric extract containing curcumin in broiler chicks. Resour Sci Res 2(1):28-38.

15.

Kim HJ, Lee MJ, Jang JY, Lee SH 2019a Allium hookeri root extract inhibits adipogenesis by promoting lipolysis in high fat diet-induced obese mice. Nutrients 11(10):2262.

16.

Kim JY, Kim AJ, Kim MJ 2019b Safety and physicochemical activities of Allium hookeri. Asian J Beauty Cosmetol 17(4):521-531.

17.

Kothari D, Lee WD, Niu KM, Kim SK 2019 The genus Allium as poultry feed additive: a review. Animals 9(12):1032.

18.

Lee EB, Lee SH, Kim SH, Kang SH, Lee KW, Kim DH, Kim DW, Kang HG, Kim NS, Kim JB, Choe JS, Jang HH, Hwang YJ, Kim YS, Lee SH 2018a Effects of dietary Allium hookeri on growth and blood biochemical parameters in broiler chickens. Kor J Pharmacogn 49(2):132-137.

19.

Lee J 2016 Physicochemical and antioxidant properties in Allium hookeri by hot air-and freeze-drying methods. Korean J Food Preserv 23(1):57-62.

20.

Lee JH, Cho S, Paik HD, Choi CW, Nam KT, Hwang SG, Kim SK 2014a Investigation on antibacterial and antioxidant activities, phenolic and flavonoid contents of some Thai edible plants as an alternative for antibiotics. Asian-Australas J Anim Sci 27(10):1461-1468.

21.

Lee KW, Kim YS, Park PJ, Jeong JH 2014b Comparison of effect of water and ethanolic extract from roots and leaves of Allium hookeri. J Korean Soc Food Sci Nutr 43(12):1808-1816.

22.

Lee SH, Bang S, Jang HH, Lee EB, Kim BS, Kim SH, Kang SH, Lee KW, Kim DW, Kim JB, Choe JS, Park SY, Lillehoj HS 2020 Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickens. Plos ONE 15(1):e0226833.

23.

Lee Y, Lee S, Gadde UD, Oh S, Lee S, Lillehoj HS 2017 Dietary Allium hookeri reduces inflammatory response and increases expression of intestinal tight junction proteins in LPS-induced young broiler chicken. Res Vet Sci 112:149-155.

24.

Lee Y, Lee SH, Lee SJ, Gadde UD, Oh ST, Han H, Lillehoj HS 2018b Effects of dietary Allium hookeri root on growth performance and antioxidant activity in young broiler chickens. Res Vet Sci 118:345-350.

25.

Lee YS, Lee SH, Gadde US, Oh ST, Lee SJ, Lillehoj HS 2018c Allium hookeri supplementation improves intestinal immune response against necrotic enteritis in young broiler chickens. Poult Sci 97(6):1899-1908.

26.

Liao X, Shao Y, Sun G, Yang Y, Zhang L, Guo Y, Luo X, Lu L 2020 The relationship among gut microbiota, short-chain fatty acids, and intestinal morphology of growing and healthy broilers. Poult Sci 99(11):5883-5895.

27.

Liu S, He L, Jiang Q, Duraipandiyan V, Al-Dhabi NA, Liu G, Yaoa K, Yin Y 2018 Effect of dietary α-ketoglutarate and allicin supplementation on the composition and diversity of the cecal microbial community in growing pigs. J Sci Food Agric 98(15):5541-5932.

28.

Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCTmethod. Methods 25(4):402-408.

29.

Manach C, Scalbert A, Morand C, Rémésy C, Jiménez L 2004 Polyphenols: food sources and bioavailability. Am J Clin Nutr 79:727-747.

30.

Nguyen AV, Soulika AM 2019 The dynamics of the skin’s immune system. Int J Mol Sci 20(8):1811.

31.

Panyod S, Wu WK, Lu KH, Liu CT, Chu YL, Ho CT, Hsiao WLW, Lai YS, Chen WC, Lin YE, Lin SH, Wu MS, Sheen LY 2020 Allicin modifies the composition and function of the gut microbiota in alcoholic hepatic steatosis mice. J Agric Food Chem 68(10):3088-3098.

32.

Park S, Kim N, Kim W, Moon J 2022 The effect of Korean native chicken breed information on consumer sensory evaluation and purchase behavior. J Anim Sci Technol 42(1):111-127.

33.

Park SY, Byeon DS, Kim GW, Kim HY 2021 Carcass and retail meat cuts quality properties of broiler chicken meat based on the slaughter age. J Anim Sci Technol 63(1): 180-190.

34.

Phuyal N, Jha PK, Raturi PP, Rajbhandary S 2020 Total phenolic, flavonoid contents, and antioxidant activities of fruit, seed, and bark extracts of Zanthoxylum armatum DC. Sci World J 2020:8780704.

35.

Portincasa P, Bonfrate L, Vacca M, Angelis MD, Farella I, Lanza E, Khalil M, Wang DQH, Sperandio M, Ciaula AD 2022 Gut microbiota and short chain fatty acids: implications in glucose homeostasis. Int J Mol Sci 23(3):1105.

36.

Qiu K, Li C, Wang J, Qi G, Gao J, Zhang H, Wu S 2021 Effects of dietary supplementation with Bacillus subtilis, as an alternative to antibiotics, on growth performance, serum immunity, and intestinal health in broiler chickens. Front Nutr 8:786878.

37.

Rho SH, You S, Kim GH, Park HJ 2020 Neuroprotective effect of Allium hookeri against H2O2-induced PC12 cell cytotoxicity by reducing oxidative stress. Food Sci Biotechnol 29:1519-1530.

38.

Schulthess J, Pandey S, Capitani M, Albrecht KCR, Arnold I, Franchini F, Chomka A, Ilott NE, Johnston DGW, Pires E, McCullagh J, Sansom SN, Arancibia-Cárcamo CV, Uhlig HH, Powrie F 2019 The short chain fatty acid butyrate imprints an antimicrobial program in macrophages. Immunity 50(2):432-445.

39.

Seomoon KM, Jang IS 2022 Application of plant flavonoids as natural antioxidants in poultry production. Korean J Poult Sci 49(4):211-220.

40.

Śliżewska K, Markowiak-Kopeć P, Żbikowski A, Szeleszczuk P 2020 The effect of synbiotic preparations on the intestinal microbiota and her metabolism in broiler chickens. Sci Rep 10:4281.

41.

Viveros A, Chamorro S, Pizarro M, Arija I, Centeno C, Brenes A 2011 Effects of dietary polyphenol-rich grape products on intestinal microflora and gut morphology in broiler chicks. Poult Sci 90(3):566-578.

42.

Wu XZ, Wen ZG, Hua JL 2019 Effects of dietary inclusion of Lactobacillus and inulin on growth performance, gut microbiota, nutrient utilization, and immune parameters in broilers. Poult Sci 98(10):4656-4663.

43.

Zhang C, Tong T, Kim CK, Liu Y, Seo HJ, Kim BS, Kang SG 2015 Antioxidant and anti-inflammatory properties of extracts from Allium hookeri root. Korean J Food Preserv 22(6):2287-7428.

44.

Zhu Q, Sun P, Zhang B, Kong L, Xiao C, Song Z 2021 Progress on gut health maintenance and antibiotic alternatives in broiler chicken production. Front Nutr 8:692839.
PMCid:PMC8636040

[공지] 한국가금학회 학술지 영문화 전환 및 논문 투고 안내


안녕하십니까, 한국가금학회 편집위원회입니다.

저희 한국가금학회는 학술지의 국제적 위상 제고와 연구 성과의 폭넓은 공유를 위해,
2025년 11월 정기총회에서 영문 학술지로의 전환을 결정한 바 있습니다.

앞으로 본 학술지는 모든 투고 논문을 영문으로 작성하여 접수받으며,
국제적인 심사 기준을 통해 고품질의 연구를 게재하고자 합니다.

새로운 도약을 위한 이번 변화에 회원 및 연구자 여러분의 적극적인 관심과 투고를 부탁드립니다.

 

1. 주요 변경 사항
 · 투고 언어: 전면 영문
 · 적용 시기: 2026년 5월 투고분부터

 

2. 학술지명 변경
 · 기존: 한국가금학회지, Korean Journal of Poultry Science
 · 변경: Poultry Science and Biotechnology

 

3. 논문 투고 및 심사 안내
 · 투고처: https://www.ekjps.org (온라인 논문 투고 시스템 링크 )
 · 투고 규정: 새로운 영문 템플릿 준수
 · 문의: 편집위원장

 

더욱 발전된 모습으로 학문 교류의 장이 될 수 있도록 최선을 다하겠습니다.

 

감사합니다.

 

(사)한국가금학회 회장 민원기 올림

(사)한국가금학회 편집위원장 허정민 올림


I don't want to open this window for a day.